Stem-loop sequence rno-mir-34a

AccessionMI0000877 (change log)
DescriptionRattus norvegicus miR-34a stem-loop
Gene family MIPF0000039; mir-34
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-34_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-34 microRNA precursor family are non-coding RNA molecules that, in mammals, give rise to three major mature miRNAs. The miR-34 family members were discovered computationally and later verified experimentally. The precursor miRNA stem-loop is processed in the cytoplasm of the cell, with the predominant miR-34 mature sequence excised from the 5' arm of the hairpin. The mature miR-34a is a part of the p53 tumor suppressor network; therefore, it is hypothesized that miR-34 dysregulation is involved in the development of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   c    u   -    a    uu        -   a          --gug   a 
5'  cggc gug agua uucu  ggcagugu cuu gcugguuguu     agu u
    |||| ||| |||| ||||  |||||||| ||| ||||||||||     |||  
3'  guug cac ucgu aaga  ccgucaua gaa cgacuaacga     ucg u
   u    -   g    g    uc        u   -          aggaa   a 
Get sequence
Deep sequencing
18981 reads, 126 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr5: 167092491-167092592 [+]
intergenic
Database links

Mature sequence rno-miR-34a-5p

Accession MIMAT0000815
Previous IDsrno-miR-34a
Sequence

20 - 

uggcagugucuuagcugguugu

 - 41

Get sequence
Deep sequencing18891 reads, 39 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-34a-3p

Accession MIMAT0017106
Previous IDsrno-miR-34a*
Sequence

64 - 

aaucagcaaguauacugcccua

 - 85

Get sequence
Deep sequencing78 reads, 12 experiments
Evidence experimental; SOLiD [3]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).