Stem-loop sequence rno-mir-34b

AccessionMI0000875 (change log)
DescriptionRattus norvegicus miR-34b stem-loop
Gene family MIPF0000039; mir-34
Literature search

49 open access papers mention rno-mir-34b
(188 sentences)

Stem-loop
        cg    -gua       uaa    c       -   g 
5' gugcu  guuu    ggcagug   uuag ugauugu agu c
   |||||  ||||    |||||||   |||| ||||||| ||| g
3' cacgg  caaa    ccgucac   aauc acuaaca ucg g
        aa    acua       cuc    -       g   u 
Get sequence
Deep sequencing
922720 reads, 4.35e+03 reads per million, 494 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr8: 55492542-55492625 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-34b
rno-mir-34bchr8: 55492542-55492625 [-]
rno-mir-34cchr8: 55492024-55492100 [-]
Database links

Mature sequence rno-miR-34b-5p

Accession MIMAT0000813
Previous IDsrno-miR-34b
Sequence

14 - 

aggcaguguaauuagcugauugu

 - 36

Get sequence
Deep sequencing912325 reads, 493 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-34b-3p

Accession MIMAT0017105
Previous IDsrno-miR-34b*
Sequence

51 - 

aaucacuaacuccacugccauc

 - 72

Get sequence
Deep sequencing10383 reads, 340 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).