Stem-loop sequence rno-mir-33

AccessionMI0000874 (change log)
DescriptionRattus norvegicus miR-33 stem-loop
Gene family MIPF0000070; mir-33
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-33. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-33 is a family of microRNA precursors, which are processed by the Dicer enzyme to give mature microRNAs. miR-33 is found in several animal species, including humans. In some species there is a single member of this family which gives the mature product mir-33. In humans there are two members of this family called mir-33a and mir-33b, which are located in intronic regions within two protein-coding genes for Sterol regulatory element-binding proteins (SREBP-2 and SREBP-1) respectively.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
                 a uu         guucu  c 
5' ccguggugcauugu g  gcauugcau     gg a
   |||||||||||||| |  |||||||||     || g
3' ggcacuacgugaca c  uguaacgug     cc u
                 c uu         ----u  a 
Get sequence
Deep sequencing
1465 reads, 0 reads per million, 38 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr7: 123431612-123431680 [+]
sense
ENSRNOT00000056041 ; Srebf2-201; intron 16
Database links

Mature sequence rno-miR-33-5p

Accession MIMAT0000812
Previous IDsrno-miR-33
Sequence

6 - 

gugcauuguaguugcauugca

 - 26

Get sequence
Deep sequencing1047 reads, 36 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-33-3p

Accession MIMAT0017104
Previous IDsrno-miR-33*
Sequence

46 - 

caauguuuccacagugcauca

 - 66

Get sequence
Deep sequencing410 reads, 31 experiments
Evidence experimental; SOLiD [3]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).