Stem-loop sequence rno-mir-33

AccessionMI0000874 (change log)
DescriptionRattus norvegicus miR-33 stem-loop
Gene family MIPF0000070; mir-33
Literature search

23 open access papers mention rno-mir-33
(123 sentences)

Stem-loop
                 a uu         guucu  c 
5' ccguggugcauugu g  gcauugcau     gg a
   |||||||||||||| |  |||||||||     || g
3' ggcacuacgugaca c  uguaacgug     cc u
                 c uu         ----u  a 
Get sequence
Deep sequencing
18473 reads, 2.12 reads per million, 471 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr7: 123431612-123431680 [+]
sense
ENSRNOT00000056041 ; Srebf2-201; intron 16
Database links

Mature sequence rno-miR-33-5p

Accession MIMAT0000812
Previous IDsrno-miR-33
Sequence

6 - 

gugcauuguaguugcauugca

 - 26

Get sequence
Deep sequencing13378 reads, 463 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-33-3p

Accession MIMAT0017104
Previous IDsrno-miR-33*
Sequence

46 - 

caauguuuccacagugcauca

 - 66

Get sequence
Deep sequencing5023 reads, 429 experiments
Evidence experimental; SOLiD [3]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).