Stem-loop sequence rno-mir-32

AccessionMI0000873 (change log)
DescriptionRattus norvegicus miR-32 stem-loop
Gene family MIPF0000069; mir-32
Stem-loop
           ug     u            - uu  c 
5' ggggauau  cacau acuaaguugcau g  gu a
   ||||||||  ||||| |||||||||||| |  ||  
3' cucuuaua  gugug ugauuuaacgua c  cg c
           gu     -            a uc  g 
Get sequence
Deep sequencing
1214 reads, 0 reads per million, 36 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr5: 73934255-73934324 [-]
sense
ENSRNOT00000064043 ; Tmem245-201; intron 14
ENSRNOT00000032299 ; Tmem245-202; intron 14
Database links

Mature sequence rno-miR-32-5p

Accession MIMAT0000811
Previous IDsrno-miR-32
Sequence

6 - 

uauugcacauuacuaaguugca

 - 27

Get sequence
Deep sequencing1140 reads, 36 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-32-3p

Accession MIMAT0017103
Previous IDsrno-miR-32*
Sequence

46 - 

gcaauuuagugugugugauauu

 - 67

Get sequence
Deep sequencing72 reads, 23 experiments
Evidence experimental; SOLiD [3]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).