Stem-loop sequence rno-mir-31a

AccessionMI0000872 (change log)
Previous IDsrno-mir-31
DescriptionRattus norvegicus miR-31a stem-loop
Gene family MIPF0000064; mir-31
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-31. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-31 has been characterised as a tumour suppressor miRNA, with its levels varying in breast cancer cells according to the metastatic state of the tumour. From its typical abundance in healthy tissue is a moderate decrease in non-metastatic breast cancer cell lines, and levels are almost completely absent in mouse and human metastatic breast cancer cell lines. There has also been observed a strong encapsulation of tumour cells expressing miR-31, as well as a reduced cell survival rate. miR-31's antimetastatic effects therefore make it a potential therapeutic target for breast cancer.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u   c   aaac ug  acu      ga     g   c         -u   gaa 
5'  gcu cug    u  ga   ggagag  ggcaa aug uggcauagc  guu   c
    ||| |||    |  ||   ||||||  ||||| ||| |||||||||  |||    
3'  cga gac    a  cu   ccuuuc  ccguu uac accguaucg  caa   u
   u   c   ---- gu  -gu      ua     a   a         uc   gag 
Get sequence
Deep sequencing
34521 reads, 208 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr5: 107206515-107206620 [+]
antisense
ENSRNOT00000053729 ; Mir3554-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-31a
rno-mir-31bchr5: 107206509-107206626 [-]
rno-mir-31achr5: 107206515-107206620 [+]
Database links

Mature sequence rno-miR-31a-5p

Accession MIMAT0000810
Previous IDsrno-miR-31
Sequence

28 - 

aggcaagaugcuggcauagcug

 - 49

Get sequence
Deep sequencing33954 reads, 39 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-31a-3p

Accession MIMAT0017102
Previous IDsrno-miR-31*
Sequence

64 - 

ugcuaugccaacauauugccauc

 - 86

Get sequence
Deep sequencing566 reads, 24 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).