Stem-loop sequence rno-mir-31a

AccessionMI0000872 (change log)
Previous IDsrno-mir-31
DescriptionRattus norvegicus miR-31a stem-loop
Gene family MIPF0000064; mir-31
Literature search

34 open access papers mention rno-mir-31a
(287 sentences)

Stem-loop
   u   c   aaac ug  acu      ga     g   c         -u   gaa 
5'  gcu cug    u  ga   ggagag  ggcaa aug uggcauagc  guu   c
    ||| |||    |  ||   ||||||  ||||| ||| |||||||||  |||    
3'  cga gac    a  cu   ccuuuc  ccguu uac accguaucg  caa   u
   u   c   ---- gu  -gu      ua     a   a         uc   gag 
Get sequence
Deep sequencing
317029 reads, 245 reads per million, 485 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr5: 107206515-107206620 [+]
antisense
ENSRNOT00000053729 ; Mir3554-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-31a
rno-mir-31bchr5: 107206509-107206626 [-]
rno-mir-31achr5: 107206515-107206620 [+]
Database links

Mature sequence rno-miR-31a-5p

Accession MIMAT0000810
Previous IDsrno-miR-31
Sequence

28 - 

aggcaagaugcuggcauagcug

 - 49

Get sequence
Deep sequencing311233 reads, 485 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-31a-3p

Accession MIMAT0017102
Previous IDsrno-miR-31*
Sequence

64 - 

ugcuaugccaacauauugccauc

 - 86

Get sequence
Deep sequencing5776 reads, 334 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).