Stem-loop sequence rno-mir-30a

AccessionMI0000870 (change log)
DescriptionRattus norvegicus miR-30a stem-loop
Gene family MIPF0000005; mir-30
Literature search

75 open access papers mention rno-mir-30a
(470 sentences)

Stem-loop
      a            uc           -----   a 
5' gca cuguaaacaucc  gacuggaagcu     gug a
   ||| ||||||||||||  |||||||||||     |||  
3' cgu gacguuuguagg  cugacuuucgg     cac g
      c            --           guaaa   c 
Get sequence
Deep sequencing
55439011 reads, 4.45e+04 reads per million, 516 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr9: 29542635-29542705 [+]
intergenic
Database links

Mature sequence rno-miR-30a-5p

Accession MIMAT0000808
Previous IDsrno-miR-30a-5p;rno-miR-30a
Sequence

6 - 

uguaaacauccucgacuggaag

 - 27

Get sequence
Deep sequencing54629841 reads, 516 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

Mature sequence rno-miR-30a-3p

Accession MIMAT0000809
Previous IDsrno-miR-30a-3p;rno-miR-30a*
Sequence

47 - 

cuuucagucggauguuugcagc

 - 68

Get sequence
Deep sequencing809167 reads, 507 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).