Stem-loop sequence rno-mir-30b

AccessionMI0000868 (change log)
DescriptionRattus norvegicus miR-30b stem-loop
Gene family MIPF0000005; mir-30
Literature search

63 open access papers mention rno-mir-30b
(413 sentences)

Stem-loop
   -     uuu     c            u   -        --   u 
5'  ccgag   caguu auguaaacaucc aca cucagcug  uca a
    |||||   ||||| |||||||||||| ||| ||||||||  |||  
3'  gguuc   gucga ugcauuuguagg ugu gggucggu  agu c
   a     --u     c            -   a        ug   a 
Get sequence
Deep sequencing
1261202 reads, 990 reads per million, 506 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Landgraf et al. show that miRNA sequences from both arms of this hairpin precursor are similarly expressed [4].

Database links

Mature sequence rno-miR-30b-5p

Accession MIMAT0000806
Previous IDsrno-miR-30b
Sequence

16 - 

uguaaacauccuacacucagcu

 - 37

Get sequence
Deep sequencing1255253 reads, 506 experiments
Evidence experimental; cloned [1-4], Northern [1,3], SOLiD [5]
Predicted targets

Mature sequence rno-miR-30b-3p

Accession MIMAT0004721
Sequence

54 - 

cugggauguggauguuuacguc

 - 75

Get sequence
Deep sequencing5944 reads, 448 experiments
Evidence experimental; cloned [4], SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).