Stem-loop sequence rno-mir-30e

AccessionMI0000867 (change log)
DescriptionRattus norvegicus miR-30e stem-loop
Gene family MIPF0000005; mir-30
Literature search

59 open access papers mention rno-mir-30e
(262 sentences)

Stem-loop
   g        uu  ua            uu           g aaggu 
5'  ggcagucu  gc  cuguaaacaucc  gacuggaagcu u     g
    ||||||||  ||  ||||||||||||  ||||||||||| |      
3'  ccgucgga  cg  gacauuuguagg  cugacuuucga g     u
   a        --  gc            --           g agagu 
Get sequence
Deep sequencing
43943484 reads, 3.5e+04 reads per million, 516 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr5: 139702872-139702963 [-]
sense
ENSRNOT00000056651 ; Nfyc-201; intron 5
Clustered miRNAs
< 10kb from rno-mir-30e
rno-mir-30echr5: 139702872-139702963 [-]
rno-mir-30c-1chr5: 139699877-139699965 [-]
Database links

Mature sequence rno-miR-30e-5p

Accession MIMAT0000805
Previous IDsrno-miR-30e
Sequence

17 - 

uguaaacauccuugacuggaag

 - 38

Get sequence
Deep sequencing43193368 reads, 516 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-30e-3p

Accession MIMAT0004720
Previous IDsrno-miR-30e*
Sequence

59 - 

cuuucagucggauguuuacagc

 - 80

Get sequence
Deep sequencing749477 reads, 507 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).