Stem-loop sequence MI0000866

Accession

MI0000866

ID

rno-mir-30c-1

Description

Rattus norvegicus miR-30c-1 stem-loop

Stem-loop

a     uu    ugu u       u   aca         ---g  a 
 ccaug  guag   g guaaaca ccu   cucucagcu    ug g
 |||||  ||||   | ||||||| |||   |||||||||    ||  
 gguac  cguc   c cauuugu ggg   gagggucgg    ac c
a     --    uuc u       u   --a         ugga  u 

Genome context

• Coordinates (RGSC3.4): 5: 141362120-141362208 [-]
• Overlapping transcripts:

  sense

  ENSRNOT00000056650 ; intron 3

  ENSRNOT00000056651 ; Nfyc; intron 5

  ENSRNOT00000014457 ; NFYC_RAT; intron 5

View flanking features

Clustered miRNAs

< 10kb from rno-mir-30c-1

• rno-mir-30e: 5: 141365115-141365206 [-]
• rno-mir-30c-1: 5: 141362120-141362208 [-]

Gene family

MIPF0000005; mir-30

Mature sequence MIMAT0000804

• Accession: MIMAT0000804
• ID: rno-miR-30c
• Sequence: 17 - uguaaacauccuacacucucagc - 39
• Evidence: experimental; cloned [1-5]
• Predicted targets:
  • MICROCOSM:rno-miR-30c
  • TARGETSCAN:rno-miR-30c

Minor miR* sequence MIMAT0004719

• Accession: MIMAT0004719
• ID: rno-miR-30c-1*
• Sequence: 56 - cugggagaggguuguuuacucc - 77
• Evidence: experimental; cloned [4]
• Predicted targets:
  • MICROCOSM:rno-miR-30c-1*
  • TARGETSCAN:rno-miR-30c-1*

References

1. "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3. "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4. "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).