Stem-loop sequence rno-mir-30c-1

AccessionMI0000866 (change log)
DescriptionRattus norvegicus miR-30c-1 stem-loop
Gene family MIPF0000005; mir-30
Literature search

60 open access papers mention rno-mir-30c-1
(505 sentences)

Stem-loop
   a     uu    ugu u       u   aca         ---g  a 
5'  ccaug  guag   g guaaaca ccu   cucucagcu    ug g
    |||||  ||||   | ||||||| |||   |||||||||    ||  
3'  gguac  cguc   c cauuugu ggg   gagggucgg    ac c
   a     --    uuc u       u   --a         ugga  u 
Get sequence
Deep sequencing
6012590 reads, 4.19e+03 reads per million, 511 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr5: 139699877-139699965 [-]
sense
ENSRNOT00000056651 ; Nfyc-201; intron 5
Clustered miRNAs
< 10kb from rno-mir-30c-1
rno-mir-30echr5: 139702872-139702963 [-]
rno-mir-30c-1chr5: 139699877-139699965 [-]
Database links

Mature sequence rno-miR-30c-5p

Accession MIMAT0000804
Previous IDsrno-miR-30c
Sequence

17 - 

uguaaacauccuacacucucagc

 - 39

Get sequence
Deep sequencing11978233 reads, 511 experiments
Evidence experimental; cloned [1-5], SOLiD [6]
Predicted targets

Mature sequence rno-miR-30c-1-3p

Accession MIMAT0004719
Previous IDsrno-miR-30c-1*
Sequence

56 - 

cugggagaggguuguuuacucc

 - 77

Get sequence
Deep sequencing23270 reads, 487 experiments
Evidence experimental; cloned [4], SOLiD [6]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
6
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).