Stem-loop sequence rno-mir-29c-1

AccessionMI0000865 (change log)
Previous IDsrno-mir-29c
DescriptionRattus norvegicus miR-29c-1 stem-loop
Gene family MIPF0000009; mir-29
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-29_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-29 microRNA precursor, or pre-miRNA, is a small RNA molecule in the shape of a stem-loop or hairpin. Each arm of the hairpin can be processed into one member of a closely related family of short non-coding RNAs that are involved in regulating gene expression. The processed, or "mature" products of the precursor molecule are known as microRNA (miRNA), and have been predicted or confirmed in a wide range of species (see 'MIPF0000009' in miRBase: the microRNA database).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a         -  ggc           ucc       ---     u 
5'  ucucuuaca ca   ugaccgauuuc   ugguguu   cagag c
    ||||||||| ||   |||||||||||   |||||||   ||||| u
3'  gggggaugu gu   auuggcuaaag   accacga   guuuu g
   a         a  ---           uuu       ucu     u 
Get sequence
Deep sequencing
206333 reads, 1.83e+03 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 38238904-38238991 [+]
antisense
ENSRNOT00000071875 ; Mir3556b-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-29c-1
rno-mir-29b-2chr1: 38238376-38238456 [+]
rno-mir-3556b-1chr1: 38238896-38239002 [-]
rno-mir-29c-1chr1: 38238904-38238991 [+]
Database links

Mature sequence rno-miR-29c-5p

Accession MIMAT0003154
Previous IDsrno-miR-29c*
Sequence

16 - 

ugaccgauuucuccugguguuc

 - 37

Get sequence
Deep sequencing1830 reads, 35 experiments
Evidence experimental; cloned [2], SOLiD [5]

Mature sequence rno-miR-29c-3p

Accession MIMAT0000803
Previous IDsrno-miR-29c
Sequence

54 - 

uagcaccauuugaaaucgguua

 - 75

Get sequence
Deep sequencing410834 reads, 39 experiments
Evidence experimental; cloned [1-4], SOLiD [5]

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).