Stem-loop sequence rno-mir-29b-1

AccessionMI0000864 (change log)
DescriptionRattus norvegicus miR-29b-1 stem-loop
Gene family MIPF0000009; mir-29
Literature search

123 open access papers mention rno-mir-29b-1
(1107 sentences)

Stem-loop
   -cu       -          u      gu      uuaaa 
5'    ucaggaa gcugguuuca auggug  uuagau     u
      ||||||| |||||||||| ||||||  ||||||     a
3'    gguucuu ugacuaaagu uaccac  gaucug     g
   ggu       g          u      --      uuagu 
Get sequence
Deep sequencing
679929 reads, 445 reads per million, 490 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr4: 58344310-58344390 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-29b-1
rno-mir-29b-1chr4: 58344310-58344390 [-]
rno-mir-3587chr4: 58344283-58344345 [+]
rno-mir-29achr4: 58343931-58344018 [-]
rno-mir-3556achr4: 58343919-58344036 [+]
Database links

Mature sequence rno-miR-29b-1-5p

Accession MIMAT0005445
Previous IDsrno-miR-29b-1*
Sequence

15 - 

uuucauauggugguuuagauuu

 - 36

Get sequence
Deep sequencing6302 reads, 396 experiments
Evidence experimental; cloned [3], SOLiD [5]
Predicted targets

Mature sequence rno-miR-29b-3p

Accession MIMAT0000801
Previous IDsrno-miR-29b
Sequence

51 - 

uagcaccauuugaaaucaguguu

 - 73

Get sequence
Deep sequencing2019100 reads, 495 experiments
Evidence experimental; cloned [1-4], SOLiD [5]

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).