Stem-loop sequence rno-mir-29a

AccessionMI0000863 (change log)
DescriptionRattus norvegicus miR-29a stem-loop
Gene family MIPF0000009; mir-29
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-29_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-29 microRNA precursor, or pre-miRNA, is a small RNA molecule in the shape of a stem-loop or hairpin. Each arm of the hairpin can be processed into one member of a closely related family of short non-coding RNAs that are involved in regulating gene expression. The processed, or "mature" products of the precursor molecule are known as microRNA (miRNA), and have been predicted or confirmed in a wide range of species (see 'MIPF0000009' in miRBase: the microRNA database).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a    uuagagg            uuu       c    ucaa 
5'  cccc       augacugauuuc   ugguguu agag    u
    ||||       ||||||||||||   ||||||| ||||    a
3'  gggg       uauuggcuaaag   accacga ucuu    g
   a    uuaguaa            ucu       -    uuaa 
Get sequence
Deep sequencing
217269 reads, 1.87e+03 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr4: 58343931-58344018 [-]
antisense
ENSRNOT00000053581 ; Mir3556a-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-29a
rno-mir-29b-1chr4: 58344310-58344390 [-]
rno-mir-3587chr4: 58344283-58344345 [+]
rno-mir-29achr4: 58343931-58344018 [-]
rno-mir-3556achr4: 58343919-58344036 [+]
Database links

Mature sequence rno-miR-29a-5p

Accession MIMAT0004718
Previous IDsrno-miR-29a*
Sequence

16 - 

acugauuucuuuugguguucag

 - 37

Get sequence
Deep sequencing470 reads, 34 experiments
Evidence experimental; cloned [4], SOLiD [5]
Predicted targets

Mature sequence rno-miR-29a-3p

Accession MIMAT0000802
Previous IDsrno-miR-29a
Sequence

54 - 

uagcaccaucugaaaucgguua

 - 75

Get sequence
Deep sequencing216799 reads, 39 experiments
Evidence experimental; cloned [1-4], SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).