Stem-loop sequence rno-mir-28

AccessionMI0000861 (change log)
DescriptionRattus norvegicus miR-28 stem-loop
Gene family MIPF0000057; mir-28
Literature search

13 open access papers mention rno-mir-28
(17 sentences)

Stem-loop
      c   a   gca                --uu   -u  cu 
5' ggu ccu ccc   aggagcucacagucua    gag  uc  u
   ||| ||| |||   ||||||||||||||||    |||  ||  u
3' uca gga ggg   uccucgaguguuagau    cuc  ag  u
      c   c   agg                cacc   uu  uc 
Get sequence
Deep sequencing
1320051 reads, 1e+03 reads per million, 507 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr11: 79380523-79380608 [-]
sense
ENSRNOT00000044279 ; Lpp-201; intron 7
Database links

Mature sequence rno-miR-28-5p

Accession MIMAT0000800
Previous IDsrno-miR-28
Sequence

14 - 

aaggagcucacagucuauugag

 - 35

Get sequence
Deep sequencing223542 reads, 499 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

Mature sequence rno-miR-28-3p

Accession MIMAT0004716
Previous IDsrno-miR-28*
Sequence

54 - 

cacuagauugugagcuccugga

 - 75

Get sequence
Deep sequencing1096508 reads, 506 experiments
Evidence experimental; cloned [3], SOLiD [4]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).