Stem-loop sequence rno-mir-27a

AccessionMI0000860 (change log)
DescriptionRattus norvegicus miR-27a stem-loop
Gene family MIPF0000036; mir-27
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-27. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-27 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-27 precursor is the microRNA mir-27. Herpesvirus saimiri expresses several non-coding RNAs (HSURs) which have been found to significantly reduce the level of mir-27 in a host cell. It has been proposed that miR-27 operates together with miR-23 and mir-24 in a co-operative cluster.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u  -  u u  a  a         ug  u       a  u  ac 
5'  gg cc g gg gc gggcuuagc  cu gugagca gg cu  a
    || || | || || |||||||||  || ||||||| || ||  g
3'  cc gg c cc cg cuugaaucg  ga cacuugu cu ga  c
   c  a  u -  c  c         gu  -       g  -  aa 
Get sequence
Deep sequencing
1809159 reads, 2.13e+04 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr19: 25318736-25318822 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-27a
rno-mir-23achr19: 25318582-25318656 [+]
rno-mir-27achr19: 25318736-25318822 [+]
rno-mir-24-2chr19: 25318863-25318970 [+]
Database links

Mature sequence rno-miR-27a-5p

Accession MIMAT0004715
Previous IDsrno-miR-27a*
Sequence

14 - 

agggcuuagcugcuugugagca

 - 35

Get sequence
Deep sequencing361 reads, 33 experiments
Evidence experimental; cloned [2], SOLiD [4]
Predicted targets

Mature sequence rno-miR-27a-3p

Accession MIMAT0000799
Previous IDsrno-miR-27a
Sequence

56 - 

uucacaguggcuaaguuccgc

 - 76

Get sequence
Deep sequencing1808772 reads, 39 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).