Stem-loop sequence rno-mir-27a

AccessionMI0000860 (change log)
DescriptionRattus norvegicus miR-27a stem-loop
Gene family MIPF0000036; mir-27
Literature search

56 open access papers mention rno-mir-27a
(596 sentences)

Stem-loop
   u  -  u u  a  a         ug  u       a  u  ac 
5'  gg cc g gg gc gggcuuagc  cu gugagca gg cu  a
    || || | || || |||||||||  || ||||||| || ||  g
3'  cc gg c cc cg cuugaaucg  ga cacuugu cu ga  c
   c  a  u -  c  c         gu  -       g  -  aa 
Get sequence
Deep sequencing
21594422 reads, 1.78e+04 reads per million, 508 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr19: 25318736-25318822 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-27a
rno-mir-23achr19: 25318582-25318656 [+]
rno-mir-27achr19: 25318736-25318822 [+]
rno-mir-24-2chr19: 25318863-25318970 [+]
Database links

Mature sequence rno-miR-27a-5p

Accession MIMAT0004715
Previous IDsrno-miR-27a*
Sequence

14 - 

agggcuuagcugcuugugagca

 - 35

Get sequence
Deep sequencing4717 reads, 429 experiments
Evidence experimental; cloned [2], SOLiD [4]
Predicted targets

Mature sequence rno-miR-27a-3p

Accession MIMAT0000799
Previous IDsrno-miR-27a
Sequence

56 - 

uucacaguggcuaaguuccgc

 - 76

Get sequence
Deep sequencing21589359 reads, 508 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).