Stem-loop sequence rno-mir-27b

AccessionMI0000859 (change log)
DescriptionRattus norvegicus miR-27b stem-loop
Gene family MIPF0000036; mir-27
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-27. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-27 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-27 precursor is the microRNA mir-27. Herpesvirus saimiri expresses several non-coding RNAs (HSURs) which have been found to significantly reduce the level of mir-27 in a host cell. It has been proposed that miR-27 operates together with miR-23 and mir-24 in a co-operative cluster.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -    -    aaca                  auug        ugau     
5'  accu cucu    aggugcagagcuuagcug    gugaacag    uggu 
    |||| ||||    ||||||||||||||||||    ||||||||    ||| u
3'  ugga gaga    uccacgucuugaaucggu    cacuuguu    gccu 
   g    a    --ag                  --ga        --uc     
Get sequence
Deep sequencing
1861152 reads, 2.17e+04 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr17: 823461-823557 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-27b
rno-mir-23bchr17: 823222-823318 [+]
rno-mir-27bchr17: 823461-823557 [+]
rno-mir-3074chr17: 823940-824056 [-]
rno-mir-24-1chr17: 823968-824035 [+]
Database links

Mature sequence rno-miR-27b-5p

Accession MIMAT0017101
Previous IDsrno-miR-27b*
Sequence

19 - 

agagcuuagcugauuggugaacag

 - 42

Get sequence
Deep sequencing1820 reads, 38 experiments
Evidence experimental; SOLiD [4]
Predicted targets

Mature sequence rno-miR-27b-3p

Accession MIMAT0000798
Previous IDsrno-miR-27b
Sequence

61 - 

uucacaguggcuaaguucugc

 - 81

Get sequence
Deep sequencing1859332 reads, 39 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).