Stem-loop sequence rno-mir-27b

AccessionMI0000859 (change log)
DescriptionRattus norvegicus miR-27b stem-loop
Gene family MIPF0000036; mir-27
Literature search

38 open access papers mention rno-mir-27b
(197 sentences)

Stem-loop
   -    -    aaca                  auug        ugau     
5'  accu cucu    aggugcagagcuuagcug    gugaacag    uggu 
    |||| ||||    ||||||||||||||||||    ||||||||    ||| u
3'  ugga gaga    uccacgucuugaaucggu    cacuuguu    gccu 
   g    a    --ag                  --ga        --uc     
Get sequence
Deep sequencing
22120693 reads, 1.81e+04 reads per million, 508 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr17: 823461-823557 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-27b
rno-mir-23bchr17: 823222-823318 [+]
rno-mir-27bchr17: 823461-823557 [+]
rno-mir-3074chr17: 823940-824056 [-]
rno-mir-24-1chr17: 823968-824035 [+]
Database links

Mature sequence rno-miR-27b-5p

Accession MIMAT0017101
Previous IDsrno-miR-27b*
Sequence

19 - 

agagcuuagcugauuggugaacag

 - 42

Get sequence
Deep sequencing24803 reads, 487 experiments
Evidence experimental; SOLiD [4]
Predicted targets

Mature sequence rno-miR-27b-3p

Accession MIMAT0000798
Previous IDsrno-miR-27b
Sequence

61 - 

uucacaguggcuaaguucugc

 - 81

Get sequence
Deep sequencing22095870 reads, 508 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).