Stem-loop sequence rno-mir-26b

AccessionMI0000858 (change log)
DescriptionRattus norvegicus miR-26b stem-loop
Gene family MIPF0000043; mir-26
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-26_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u  -    ga   -   u        uc         ug    g 
5'  gc ccgg  ccc agu caaguaau  aggauaggu  uggu c
    || ||||  ||| ||| ||||||||  |||||||||  ||||  
3'  cg ggcc  ggg ucg guucauua  ucuuguccg  accg u
   c  u    gg   c   -        cc         --    g 
Get sequence
Deep sequencing
2476178 reads, 2.84e+04 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr9: 81675275-81675359 [+]
sense
ENSRNOT00000020646 ; Ctdsp1-201; intron 5
Database links

Mature sequence rno-miR-26b-5p

Accession MIMAT0000797
Previous IDsrno-miR-26b
Sequence

15 - 

uucaaguaauucaggauaggu

 - 35

Get sequence
Deep sequencing2475300 reads, 39 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

Mature sequence rno-miR-26b-3p

Accession MIMAT0004714
Previous IDsrno-miR-26b*
Sequence

51 - 

ccuguucuccauuacuuggcuc

 - 72

Get sequence
Deep sequencing877 reads, 38 experiments
Evidence experimental; cloned [3], SOLiD [4]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).