Stem-loop sequence rno-mir-26b

AccessionMI0000858 (change log)
DescriptionRattus norvegicus miR-26b stem-loop
Gene family MIPF0000043; mir-26
Literature search

40 open access papers mention rno-mir-26b
(167 sentences)

Stem-loop
   u  -    ga   -   u        uc         ug    g 
5'  gc ccgg  ccc agu caaguaau  aggauaggu  uggu c
    || ||||  ||| ||| ||||||||  |||||||||  ||||  
3'  cg ggcc  ggg ucg guucauua  ucuuguccg  accg u
   c  u    gg   c   -        cc         --    g 
Get sequence
Deep sequencing
40582304 reads, 3.34e+04 reads per million, 514 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr9: 81675275-81675359 [+]
sense
ENSRNOT00000020646 ; Ctdsp1-201; intron 5
Database links

Mature sequence rno-miR-26b-5p

Accession MIMAT0000797
Previous IDsrno-miR-26b
Sequence

15 - 

uucaaguaauucaggauaggu

 - 35

Get sequence
Deep sequencing40571973 reads, 514 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

Mature sequence rno-miR-26b-3p

Accession MIMAT0004714
Previous IDsrno-miR-26b*
Sequence

51 - 

ccuguucuccauuacuuggcuc

 - 72

Get sequence
Deep sequencing10321 reads, 472 experiments
Evidence experimental; cloned [3], SOLiD [4]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).