Stem-loop sequence rno-mir-25

AccessionMI0000856 (change log)
DescriptionRattus norvegicus miR-25 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
       a ug   ag    g      c g     u   --  ac 
5' ggcc g  uug  aggc gagaca g gcaau gcu  gg  g
   |||| |  |||  |||| |||||| | ||||| |||  ||  c
3' ccgg c  gac  ucug cucugu c cguua cgg  cc  u
       c gu   ag    g      u a     -   gu  cg 
Get sequence
Deep sequencing
243715 reads, 1.36e+03 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr12: 19307340-19307423 [-]
sense
ENSRNOT00000001825 ; Mcm7-201; intron 12
Clustered miRNAs
< 10kb from rno-mir-25
rno-mir-106bchr12: 19307752-19307833 [-]
rno-mir-93chr12: 19307543-19307629 [-]
rno-mir-25chr12: 19307340-19307423 [-]
Database links

Mature sequence rno-miR-25-5p

Accession MIMAT0004713
Previous IDsrno-miR-25*
Sequence

14 - 

aggcggagacacgggcaauugc

 - 35

Get sequence
Deep sequencing587 reads, 31 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-25-3p

Accession MIMAT0000795
Previous IDsrno-miR-25
Sequence

52 - 

cauugcacuugucucggucuga

 - 73

Get sequence
Deep sequencing243128 reads, 39 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).