Stem-loop sequence rno-mir-25

AccessionMI0000856 (change log)
DescriptionRattus norvegicus miR-25 stem-loop
Gene family MIPF0000013; mir-25
Literature search

25 open access papers mention rno-mir-25
(184 sentences)

Stem-loop
       a ug   ag    g      c g     u   --  ac 
5' ggcc g  uug  aggc gagaca g gcaau gcu  gg  g
   |||| |  |||  |||| |||||| | ||||| |||  ||  c
3' ccgg c  gac  ucug cucugu c cguua cgg  cc  u
       c gu   ag    g      u a     -   gu  cg 
Get sequence
Deep sequencing
1332437 reads, 1.01e+03 reads per million, 503 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr12: 19307340-19307423 [-]
sense
ENSRNOT00000001825 ; Mcm7-201; intron 12
Clustered miRNAs
< 10kb from rno-mir-25
rno-mir-106bchr12: 19307752-19307833 [-]
rno-mir-93chr12: 19307543-19307629 [-]
rno-mir-25chr12: 19307340-19307423 [-]
Database links

Mature sequence rno-miR-25-5p

Accession MIMAT0004713
Previous IDsrno-miR-25*
Sequence

14 - 

aggcggagacacgggcaauugc

 - 35

Get sequence
Deep sequencing3683 reads, 397 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-25-3p

Accession MIMAT0000795
Previous IDsrno-miR-25
Sequence

52 - 

cauugcacuugucucggucuga

 - 73

Get sequence
Deep sequencing1328751 reads, 503 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).