Stem-loop sequence rno-mir-24-2

AccessionMI0000855 (change log)
DescriptionRattus norvegicus miR-24-2 stem-loop
Gene family MIPF0000041; mir-24
Literature search

39 open access papers mention rno-mir-24-2
(183 sentences)

Stem-loop
   -   -u    ---cu     ccgc       g   a         aa    ug  u 
5'  gcc  cucc     gggcu    cuccugu ccu cugagcuga  cagu  au c
    |||  ||||     |||||    ||||||| ||| |||||||||  ||||  ||  
3'  cgg  gagg     cccga    gaggaca gga gacuugacu  guca  ug c
   a   uc    auacc     -ccu       a   c         cg    cg  a 
Get sequence
Deep sequencing
724928 reads, 451 reads per million, 494 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr19: 25318863-25318970 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-24-2
rno-mir-23achr19: 25318582-25318656 [+]
rno-mir-27achr19: 25318736-25318822 [+]
rno-mir-24-2chr19: 25318863-25318970 [+]
Database links

Mature sequence rno-miR-24-2-5p

Accession MIMAT0005441
Previous IDsrno-miR-24-2*
Sequence

25 - 

gugccuacugagcugaaacagu

 - 46

Get sequence
Deep sequencing151634 reads, 490 experiments
Evidence experimental; cloned [3], SOLiD [5]
Predicted targets

Mature sequence rno-miR-24-3p

Accession MIMAT0000794
Previous IDsrno-miR-24
Sequence

61 - 

uggcucaguucagcaggaacag

 - 82

Get sequence
Deep sequencing1146242 reads, 492 experiments
Evidence experimental; cloned [1-4], Northern [2], SOLiD [5]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).