Stem-loop sequence rno-mir-24-1

AccessionMI0000854 (change log)
DescriptionRattus norvegicus miR-24-1 stem-loop
Gene family MIPF0000041; mir-24
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-24_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-24 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. miR-24 is conserved in various species, and is clustered with miR-23 and miR-27, on human chromosome 9 and 19. Recently, miR-24 has been shown to suppress expression of two crucial cell cycle control genes, E2F2 and Myc in hematopoietic differentiation and also to promote keratinocyte differentiation by repressing actin-cytoskeleton regulators PAK4, Tsk5 and ArhGAP19.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       g  g   a         ua     ucuca 
5' cucc gu ccu cugagcuga  ucagu     u
   |||| || ||| |||||||||  |||||     u
3' gagg ca gga gacuugacu  gguca     u
       a  a   c         -c     cacac 
Get sequence
Deep sequencing
36711 reads, 362 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr17: 823968-824035 [+]
antisense
ENSRNOT00000053691 ; Mir3074-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-24-1
rno-mir-23bchr17: 823222-823318 [+]
rno-mir-27bchr17: 823461-823557 [+]
rno-mir-3074chr17: 823940-824056 [-]
rno-mir-24-1chr17: 823968-824035 [+]
Database links

Mature sequence rno-miR-24-1-5p

Accession MIMAT0003153
Previous IDsrno-miR-189;rno-miR-24-1*
Sequence

6 - 

gugccuacugagcugauaucag

 - 27

Get sequence
Deep sequencing476 reads, 34 experiments
Evidence experimental; cloned [2-3], Northern [2], SOLiD [5]
Predicted targets

Mature sequence rno-miR-24-3p

Accession MIMAT0000794
Previous IDsrno-miR-24
Sequence

44 - 

uggcucaguucagcaggaacag

 - 65

Get sequence
Deep sequencing72478 reads, 39 experiments
Evidence experimental; cloned [1-4], Northern [2], SOLiD [5]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).