Stem-loop sequence rno-mir-23a

AccessionMI0000852 (change log)
DescriptionRattus norvegicus miR-23a stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
   c  c   c     -       g    g      a  c 
5'  gg cgg ugggg uuccugg gaug gauuug ug c
    || ||| ||||| ||||||| |||| |||||| || a
3'  cc guc accuu agggacc uuac cuaaac ac g
   c  a   a     u       g    a      -  u 
Get sequence
Deep sequencing
75432 reads, 921 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr19: 25318582-25318656 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-23a
rno-mir-23achr19: 25318582-25318656 [+]
rno-mir-27achr19: 25318736-25318822 [+]
rno-mir-24-2chr19: 25318863-25318970 [+]
Database links

Mature sequence rno-miR-23a-5p

Accession MIMAT0004712
Previous IDsrno-miR-23a*
Sequence

10 - 

gggguuccuggggaugggauuu

 - 31

Get sequence
Deep sequencing9 reads, 7 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-23a-3p

Accession MIMAT0000792
Previous IDsrno-miR-23a
Sequence

46 - 

aucacauugccagggauuucc

 - 66

Get sequence
Deep sequencing75423 reads, 39 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).