Stem-loop sequence rno-mir-22

AccessionMI0000851 (change log)
DescriptionRattus norvegicus miR-22 stem-loop
Gene family MIPF0000053; mir-22
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-22. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-22 microRNA is a short RNA molecule. MicroRNAs are an abundant class of molecules, approximately 22 nucleotides in length, which can post-transcriptionally regulate gene expression by binding to the 3’ UTR of mRNAs expressed in a cell.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a  --    u   cc               -     a      u  ccu 
5'  cc  uggc gag  gcaguaguucuucag uggca gcuuua gu   g
    ||  |||| |||  ||||||||||||||| ||||| |||||| ||   a
3'  gg  accg cuc  cguugucaagaaguu accgu cgaaau cg   c
   c  uc    u   -c               g     -      -  acc 
Get sequence
Deep sequencing
7174955 reads, 7.77e+04 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 62299592-62299686 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-22
rno-mir-6326chr10: 62299339-62299449 [+]
rno-mir-22chr10: 62299592-62299686 [+]
Database links

Mature sequence rno-miR-22-5p

Accession MIMAT0003152
Previous IDsrno-miR-22*
Sequence

19 - 

aguucuucaguggcaagcuuua

 - 40

Get sequence
Deep sequencing2131 reads, 37 experiments
Evidence experimental; cloned [2-3], SOLiD [5]
Predicted targets

Mature sequence rno-miR-22-3p

Accession MIMAT0000791
Previous IDsrno-miR-22
Sequence

57 - 

aagcugccaguugaagaacugu

 - 78

Get sequence
Deep sequencing7172824 reads, 39 experiments
Evidence experimental; cloned [1-4], SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).