Stem-loop sequence rno-mir-21

Accession MI0000850
Description Rattus norvegicus miR-21 stem-loop
Gene family MIPF0000060; mir-21
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MIRN21. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

microRNA 21 also known as hsa-mir-21 or miRNA21 is a mammalian microRNA that is encoded by the MIR21 gene. MIRN21 was one of the first mammalian microRNAs identified. The mature miR-21 sequence is strongly conserved throughout evolution. The human microRNA-21 gene is located on plus strand of chromosome 17q23.2 (55273409–55273480) within a coding gene TMEM49 (also called vacuole membrane protein). Despite being located in intronic regions of a coding gene in the direction of transcription, it has its own promoter regions and forms a ~3433-nt long primary transcript of miR-21 (known as pri-miR-21) which is independently transcribed. The stem–loop recursor of miR-21(pre-miR-21) resides between nucleotides 2445 and 2516 of pri-miR-21.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u      ccu      gu        a     a     a    u a 
 guacca   ugucgg  agcuuauc gacug uguug cugu g a
 ||||||   ||||||  |||||||| ||||| ||||| |||| | u
 uauggu   acaguc  ucggguag cugac acaac ggua c c
c      uuu      ug        -     g     -    - u 
Get sequence
Genome context
Coordinates (RGSC3.4) Overlapping transcripts
10: 74864500-74864591 [-]
intergenic
Database links

Mature sequence rno-miR-21-5p

Accession MIMAT0000790
Previous IDs rno-miR-21
Sequence

18 - 

uagcuuaucagacugauguuga

 - 39

Get sequence
Evidence experimental; cloned [1-4], SOLiD [5]
Validated targets
Predicted targets

Mature sequence rno-miR-21-3p

Accession MIMAT0004711
Previous IDs rno-miR-21*
Sequence

56 - 

caacagcagucgaugggcuguc

 - 77

Get sequence
Evidence experimental; cloned [3], SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).