Stem-loop sequence rno-mir-19a

AccessionMI0000849 (change log)
DescriptionRattus norvegicus miR-19a stem-loop
Gene family MIPF0000011; mir-19
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-19_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

There are 89 known sequences today in the microRNA 19 (miR-19) family but it will change quickly. They are found in a large number of vertebrate species. The miR-19 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. Within the human and mouse genome there are three copies of this microRNA that are processed from multiple predicted precursor hairpins: mouse: * miR-19a on chromosome 14 (MI0000688) * miR-19b-1 on chromosome 14 (MI0000718) * miR-19b-2 on chromosome X (MI0000546) human: * miR-19a on chromosome 13 (MI0000073) * miR-19b-1 on chromosome 13 (MI0000074) * miR-19b-2 on chromosome X (MI000075). MiR-19 has now been predicted or experimentally confirmed (MIPF0000011). In this case the mature sequence is excised from the 3' arm of the hairpin precursor.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       c  u     c           --      ---    ag 
5' gcag cc cuguu guuuugcauag  uugcac   uaca  a
   |||| || ||||| |||||||||||  ||||||   ||||  a
3' cguc gg gguag caaaacguauc  aacgug   augu  g
       c  u     u           ua      uug    aa 
Get sequence
Deep sequencing
15942 reads, 131 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr15: 100180162-100180243 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-19a
rno-mir-17-1chr15: 100179879-100179962 [+]
rno-mir-18achr15: 100180015-100180110 [+]
rno-mir-19achr15: 100180162-100180243 [+]
rno-mir-20achr15: 100180334-100180418 [+]
rno-mir-19b-1chr15: 100180464-100180550 [+]
rno-mir-92a-1chr15: 100180586-100180663 [+]
Database links

Mature sequence rno-miR-19a-5p

Accession MIMAT0017098
Previous IDsrno-miR-19a*
Sequence

13 - 

ucguuuugcauaguugcacu

 - 32

Get sequence
Deep sequencing104 reads, 27 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-19a-3p

Accession MIMAT0000789
Previous IDsrno-miR-19a
Sequence

49 - 

ugugcaaaucuaugcaaaacuga

 - 71

Get sequence
Deep sequencing15838 reads, 39 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).