Stem-loop sequence rno-mir-19b-2

AccessionMI0000848 (change log)
DescriptionRattus norvegicus miR-19b-2 stem-loop
Gene family MIPF0000011; mir-19
Literature search

42 open access papers mention rno-mir-19b-2
(175 sentences)

Stem-loop
         cuac                 --        guu    -      g 
5' acauug    uuacgguuaguuuugca  gauuugca   cagc guauau u
   ||||||    |||||||||||||||||  ||||||||   |||| ||||||  
3' uguagu    aguguuagucaaaacgu  cuaaacgu   gucg uauaua g
         ----                 ac        ---    g      g 
Get sequence
Deep sequencing
155526 reads, 153 reads per million, 499 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 140117379-140117474 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-19b-2
rno-mir-17-2chrX: 140117891-140117968 [-]
rno-mir-20bchrX: 140117518-140117589 [-]
rno-mir-19b-2chrX: 140117379-140117474 [-]
rno-mir-92a-2chrX: 140117249-140117340 [-]
rno-mir-363chrX: 140117098-140117184 [-]
Database links

Mature sequence rno-miR-19b-2-5p

Accession MIMAT0017097
Previous IDsrno-miR-19b-2*
Sequence

19 - 

aguuuugcagauuugcaguucag

 - 41

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLiD [4]
Predicted targets

Mature sequence rno-miR-19b-3p

Accession MIMAT0000788
Previous IDsrno-miR-19b
Sequence

62 - 

ugugcaaauccaugcaaaacuga

 - 84

Get sequence
Deep sequencing310991 reads, 499 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).