Stem-loop sequence rno-mir-19b-1

AccessionMI0000847 (change log)
DescriptionRattus norvegicus miR-19b-1 stem-loop
Gene family MIPF0000011; mir-19
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-19_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

There are 89 known sequences today in the microRNA 19 (miR-19) family but it will change quickly. They are found in a large number of vertebrate species. The miR-19 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. Within the human and mouse genome there are three copies of this microRNA that are processed from multiple predicted precursor hairpins: mouse: * miR-19a on chromosome 14 (MI0000688) * miR-19b-1 on chromosome 14 (MI0000718) * miR-19b-2 on chromosome X (MI0000546) human: * miR-19a on chromosome 13 (MI0000073) * miR-19b-1 on chromosome 13 (MI0000074) * miR-19b-2 on chromosome X (MI000075). MiR-19 has now been predicted or experimentally confirmed (MIPF0000011). In this case the mature sequence is excised from the 3' arm of the hairpin precursor.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       ggu                 -  -      uc    uguau 
5' cacu   cuaugguuaguuuugca gg uuugca  cagc     a
   ||||   ||||||||||||||||| || ||||||  ||||     a
3' gugg   ggugucagucaaaacgu cc aaacgu  gucg     u
       --u                 a  u      --    ucuua 
Get sequence
Deep sequencing
16214 reads, 131 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr15: 100180464-100180550 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-19b-1
rno-mir-17-1chr15: 100179879-100179962 [+]
rno-mir-18achr15: 100180015-100180110 [+]
rno-mir-19achr15: 100180162-100180243 [+]
rno-mir-20achr15: 100180334-100180418 [+]
rno-mir-19b-1chr15: 100180464-100180550 [+]
rno-mir-92a-1chr15: 100180586-100180663 [+]
Database links

Mature sequence rno-miR-19b-1-5p

Accession MIMAT0017096
Previous IDsrno-miR-19b-1*
Sequence

16 - 

aguuuugcagguuugcauccag

 - 37

Get sequence
Deep sequencing12 reads, 8 experiments
Evidence experimental; SOLiD [4]
Predicted targets

Mature sequence rno-miR-19b-3p

Accession MIMAT0000788
Previous IDsrno-miR-19b
Sequence

54 - 

ugugcaaauccaugcaaaacuga

 - 76

Get sequence
Deep sequencing32411 reads, 39 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).