Stem-loop sequence rno-mir-17-1

AccessionMI0000845 (change log)
Previous IDsrno-mir-17
DescriptionRattus norvegicus miR-17-1 stem-loop
Gene family MIPF0000001; mir-17
Literature search

72 open access papers mention rno-mir-17-1
(564 sentences)

Stem-loop
        g         -        a  g     guagu    u 
5' gucag auaauguca aagugcuu ca ugcag     ggug g
   ||||| ||||||||| |||||||| || |||||     ||||  
3' caguc uguuacggu uucacgga gu acguc     cuac u
        g         g        a  g     ---au    g 
Get sequence
Deep sequencing
105039 reads, 42.6 reads per million, 495 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr15: 100179879-100179962 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-17-1
rno-mir-17-1chr15: 100179879-100179962 [+]
rno-mir-18achr15: 100180015-100180110 [+]
rno-mir-19achr15: 100180162-100180243 [+]
rno-mir-20achr15: 100180334-100180418 [+]
rno-mir-19b-1chr15: 100180464-100180550 [+]
rno-mir-92a-1chr15: 100180586-100180663 [+]
Database links

Mature sequence rno-miR-17-5p

Accession MIMAT0000786
Previous IDsrno-miR-17
Sequence

14 - 

caaagugcuuacagugcagguag

 - 36

Get sequence
Deep sequencing192321 reads, 492 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-17-1-3p

Accession MIMAT0004710
Previous IDsrno-miR-17-3p
Sequence

51 - 

acugcagugaaggcacuugugg

 - 72

Get sequence
Deep sequencing8924 reads, 472 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).