Stem-loop sequence rno-mir-17-1

AccessionMI0000845 (change log)
Previous IDsrno-mir-17
DescriptionRattus norvegicus miR-17-1 stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20a/b, miR-93, and miR-106a/b. With the exception of miR-93, these microRNAs are produced from several microRNA gene clusters, which apparently arose from a series of ancient evolutionary genetic duplication events, and also include members of the miR-19, and miR-25 families. These clusters are transcribed as long non-coding RNA transcripts that are processed to form ~70 nucleotide microRNA precursors, that are subsequently processed by the Dicer enzyme to give a ~22 nucleotide products. The mature microRNA products are thought to regulate expression levels of other genes through complementarity to the 3' UTR of specific target messenger RNA. The paralogous miRNA gene clusters that give rise to miR-17 family microRNAs (miR-17~92, miR-106a~363, and miR-106b~25) have been implicated in a wide variety of malignancies and are sometimes referred to as oncomirs. The oncogenic potential of these non-protein encoding genes was first identified in mouse viral tumorigenesis screens. In humans, the activating mutations of miR-17~92 have been identified in non-Hodgkin's lymphoma, whereas the miRNA constituents of the clusters are overexpressed in a multiple cancer types. High level expression of miR-17 family members induces cell proliferation, whereas deletion of the miR-17~92 cluster, in mice, is lethal and causes lung and lymphoid cell developmental defects.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
        g         -        a  g     guagu    u 
5' gucag auaauguca aagugcuu ca ugcag     ggug g
   ||||| ||||||||| |||||||| || |||||     ||||  
3' caguc uguuacggu uucacgga gu acguc     cuac u
        g         g        a  g     ---au    g 
Get sequence
Deep sequencing
18466 reads, 51.3 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr15: 100179879-100179962 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-17-1
rno-mir-17-1chr15: 100179879-100179962 [+]
rno-mir-18achr15: 100180015-100180110 [+]
rno-mir-19achr15: 100180162-100180243 [+]
rno-mir-20achr15: 100180334-100180418 [+]
rno-mir-19b-1chr15: 100180464-100180550 [+]
rno-mir-92a-1chr15: 100180586-100180663 [+]
Database links

Mature sequence rno-miR-17-5p

Accession MIMAT0000786
Previous IDsrno-miR-17
Sequence

14 - 

caaagugcuuacagugcagguag

 - 36

Get sequence
Deep sequencing34855 reads, 39 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-17-1-3p

Accession MIMAT0004710
Previous IDsrno-miR-17-3p
Sequence

51 - 

acugcagugaaggcacuugugg

 - 72

Get sequence
Deep sequencing1045 reads, 37 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).