Stem-loop sequence rno-mir-16

AccessionMI0000844 (change log)
DescriptionRattus norvegicus miR-16 stem-loop
Gene family MIPF0000006; mir-15
Literature search

67 open access papers mention rno-mir-16
(658 sentences)

Stem-loop
   caua     uc    cu         ua        c  ag   aau 
5'     cuugu  cgcu  agcagcacg  aauauugg gu  uga   a
       |||||  ||||  |||||||||  |||||||| ||  |||    
3'     ggaca  guga  ucgucgugu  uuauaacc ca  auu   a
   auag     gu    uu         ua        a  -a   aua 
Get sequence
Deep sequencing
6841690 reads, 5.36e+03 reads per million, 513 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr2: 165606072-165606166 [+]
sense
ENSRNOT00000013931 ; Smc4-201; intron 5
Clustered miRNAs
< 10kb from rno-mir-16
rno-mir-15bchr2: 165605923-165606020 [+]
rno-mir-16chr2: 165606072-165606166 [+]
Database links

Mature sequence rno-miR-16-5p

Accession MIMAT0000785
Previous IDsrno-miR-16
Sequence

17 - 

uagcagcacguaaauauuggcg

 - 38

Get sequence
Deep sequencing6840273 reads, 513 experiments
Evidence experimental; cloned [1-4], Northern [1,3], SOLiD [5]
Predicted targets

Mature sequence rno-miR-16-3p

Accession MIMAT0017094
Previous IDsrno-miR-16*
Sequence

59 - 

accaauauuauugugcugcuu

 - 79

Get sequence
Deep sequencing1416 reads, 358 experiments
Evidence experimental; SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).