Stem-loop sequence rno-mir-16

AccessionMI0000844 (change log)
DescriptionRattus norvegicus miR-16 stem-loop
Gene family MIPF0000006; mir-15
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-16_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-16 microRNA precursor family is a group of related small non-coding RNA genes that regulates gene expression. miR-16, miR-15, mir-195 and miR-457 are related microRNA precursor sequences from the mir-15 gene family. This microRNA family appears to be vertebrate specific and its members have been predicted or experimentally validated in a wide range of vertebrate species (MIPF0000006).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   caua     uc    cu         ua        c  ag   aau 
5'     cuugu  cgcu  agcagcacg  aauauugg gu  uga   a
       |||||  ||||  |||||||||  |||||||| ||  |||    
3'     ggaca  guga  ucgucgugu  uuauaacc ca  auu   a
   auag     gu    uu         ua        a  -a   aua 
Get sequence
Deep sequencing
834951 reads, 6.33e+03 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr2: 165606072-165606166 [+]
sense
ENSRNOT00000013931 ; Smc4-201; intron 5
Clustered miRNAs
< 10kb from rno-mir-16
rno-mir-15bchr2: 165605923-165606020 [+]
rno-mir-16chr2: 165606072-165606166 [+]
Database links

Mature sequence rno-miR-16-5p

Accession MIMAT0000785
Previous IDsrno-miR-16
Sequence

17 - 

uagcagcacguaaauauuggcg

 - 38

Get sequence
Deep sequencing834835 reads, 39 experiments
Evidence experimental; cloned [1-4], Northern [1,3], SOLiD [5]
Predicted targets

Mature sequence rno-miR-16-3p

Accession MIMAT0017094
Previous IDsrno-miR-16*
Sequence

59 - 

accaauauuauugugcugcuu

 - 79

Get sequence
Deep sequencing116 reads, 29 experiments
Evidence experimental; SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).