Stem-loop sequence rno-mir-15b

AccessionMI0000843 (change log)
DescriptionRattus norvegicus miR-15b stem-loop
Gene family MIPF0000006; mir-15
Literature search

40 open access papers mention rno-mir-15b
(137 sentences)

Stem-loop
   u    --a       gua   u       c  c      ua   a  ac 
5'  ugga   ccuuaaa   cug agcagca au augguu  cau cu  a
    ||||   |||||||   ||| ||||||| || ||||||  ||| ||  g
3'  acuu   ggaauuu   gau ucgucgu ua uacuaa  gua ga  u
   u    aaa       aaa   c       u  u      gc   -  ac 
Get sequence
Deep sequencing
110030 reads, 54.2 reads per million, 493 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr2: 165605923-165606020 [+]
sense
ENSRNOT00000013931 ; Smc4-201; intron 5
Clustered miRNAs
< 10kb from rno-mir-15b
rno-mir-15bchr2: 165605923-165606020 [+]
rno-mir-16chr2: 165606072-165606166 [+]
Database links

Mature sequence rno-miR-15b-5p

Accession MIMAT0000784
Previous IDsrno-miR-15b
Sequence

20 - 

uagcagcacaucaugguuuaca

 - 41

Get sequence
Deep sequencing104028 reads, 493 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

Mature sequence rno-miR-15b-3p

Accession MIMAT0017093
Previous IDsrno-miR-15b*
Sequence

58 - 

cgaaucauuauuugcugcucua

 - 79

Get sequence
Deep sequencing5451 reads, 450 experiments
Evidence experimental; SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).