Stem-loop sequence rno-mir-10b

AccessionMI0000842 (change log)
DescriptionRattus norvegicus miR-10b stem-loop
Gene family MIPF0000033; mir-10
Literature search

28 open access papers mention rno-mir-10b
(139 sentences)

Stem-loop
   cca     guaa     u        a    g     c          -ug  ac 
5'    aaguu    cguug cuauauau cccu uagaa cgaauuugug   gu  c
      |||||    ||||| |||||||| |||| ||||| ||||||||||   ||   
3'    uucaa    guagc gguauaua gggg aucuu gcuuagacac   ua  c
   -ac     aaac     u        a    -     a          uga  ca 
Get sequence
Deep sequencing
152319398 reads, 1.15e+05 reads per million, 510 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr3: 61647978-61648086 [+]
sense
ENSRNOT00000002145 ; Hoxd4-201; intron 4
Database links

Mature sequence rno-miR-10b-5p

Accession MIMAT0000783
Previous IDsrno-miR-10b
Sequence

28 - 

cccuguagaaccgaauuugugu

 - 49

Get sequence
Deep sequencing152311540 reads, 510 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-10b-3p

Accession MIMAT0017092
Previous IDsrno-miR-10b*
Sequence

65 - 

acagauucgauucuaggggaa

 - 85

Get sequence
Deep sequencing7826 reads, 298 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).