Stem-loop sequence rno-mir-10a

AccessionMI0000841 (change log)
DescriptionRattus norvegicus miR-10a stem-loop
Gene family MIPF0000033; mir-10
Literature search

31 open access papers mention rno-mir-10a
(164 sentences)

Stem-loop
   -----gacc   --c    uu        a    g     c          uaaggaa 
5'          ugu   uguc  cuguauau cccu uagau cgaauuugug       u
            |||   ||||  |||||||| |||| ||||| ||||||||||        
3'          aca   acag  gauguaua gggg aucua gcuuaaacac       u
   acucgccuc   aau    uu        a    -     u          ugguguu 
Get sequence
Deep sequencing
152474022 reads, 1.15e+05 reads per million, 510 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 84165950-84166059 [+]
intergenic
Database links

Mature sequence rno-miR-10a-5p

Accession MIMAT0000782
Previous IDsrno-miR-10a
Sequence

22 - 

uacccuguagauccgaauuugug

 - 44

Get sequence
Deep sequencing152447622 reads, 510 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-10a-3p

Accession MIMAT0004709
Sequence

63 - 

caaauucguaucuaggggaaua

 - 84

Get sequence
Deep sequencing26185 reads, 405 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).