Stem-loop sequence rno-mir-9a-1

AccessionMI0000838 (change log)
Previous IDsrno-mir-9-1
DescriptionRattus norvegicus miR-9a-1 stem-loop
Gene family MIPF0000014; mir-9
Literature search

78 open access papers mention rno-mir-9a-1
(722 sentences)

Stem-loop
   c       guug   uc               g      u  ug 
5'  gggguug    uua  uuugguuaucuagcu uaugag gg  u
    |||||||    |||  ||||||||||||||| |||||| ||  g
3'  ccccaau    aau  aagccaauagaucga auacuu cu  g
   a       -aaa   ga               a      -  ga 
Get sequence
Deep sequencing
6423128 reads, 7.71e+03 reads per million, 495 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr2: 187582799-187582887 [+]
antisense
ENSRNOT00000053674 ; Mir3597-1-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-9a-1
rno-mir-9b-1chr2: 187582790-187582897 [-]
rno-mir-9a-1chr2: 187582799-187582887 [+]
Database links

Mature sequence rno-miR-9a-5p

Accession MIMAT0000781
Previous IDsrno-miR-9
Sequence

16 - 

ucuuugguuaucuagcuguauga

 - 38

Get sequence
Deep sequencing18734206 reads, 494 experiments
Evidence experimental; cloned [1-4], SOLiD [5]
Predicted targets

Mature sequence rno-miR-9a-3p

Accession MIMAT0004708
Previous IDsrno-miR-9*
Sequence

55 - 

auaaagcuagauaaccgaaagu

 - 76

Get sequence
Deep sequencing535268 reads, 324 experiments
Evidence experimental; cloned [3], SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).