Stem-loop sequence rno-mir-7b

AccessionMI0000837 (change log)
DescriptionRattus norvegicus miR-7b stem-loop
Gene family MIPF0000022; mir-7
Literature search

33 open access papers mention rno-mir-7b
(71 sentences)

Stem-loop
   aggccagaacacau   -   aug     u  aagac         u      c  au 
5'               gag cca   cuaug gg     uugugauuu guuguu ug  a
                 ||| |||   ||||| ||     ||||||||| |||||| ||   
3'               cuc ggu   gauac cc     gacacugaa caacag au  u
   ----uuccacuacc   a   -ga     u  -gacc         -      u  ag 
Get sequence
Deep sequencing
50713 reads, 17 reads per million, 458 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr9: 10812432-10812541 [-]
intergenic
Database links

Mature sequence rno-miR-7b

Accession MIMAT0000780
Sequence

29 - 

uggaagacuugugauuuuguugu

 - 51

Get sequence
Deep sequencing50144 reads, 458 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).