Stem-loop sequence rno-mir-7a-2

AccessionMI0000836 (change log)
Previous IDsrno-mir-7-2
DescriptionRattus norvegicus miR-7a-2 stem-loop
Gene family MIPF0000022; mir-7
Literature search

42 open access papers mention rno-mir-7a-2
(245 sentences)

Stem-loop
   -ggaca       c    c   a     a u     u       u uc 
5'       gaccagc cugu ugg agacu g gauuu guuguug g  u
         ||||||| |||| ||| ||||| | ||||| ||||||| |  g
3'       cugguug ggua acc ucuga c cugaa caacaac c  u
   acuaca       u    c   g     c -     -       - ug 
Get sequence
Deep sequencing
58332 reads, 16.9 reads per million, 462 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 140576396-140576490 [+]
intergenic
Database links

Mature sequence rno-miR-7a-5p

Accession MIMAT0000606
Previous IDsrno-miR-7;rno-miR-7a
Sequence

19 - 

uggaagacuagugauuuuguugu

 - 41

Get sequence
Deep sequencing102415 reads, 459 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-7a-2-3p

Accession MIMAT0017091
Previous IDsrno-miR-7a-2*
Sequence

57 - 

caacaagucccagucugccaca

 - 78

Get sequence
Deep sequencing7134 reads, 227 experiments
Evidence experimental; SOLiD [3]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).