Stem-loop sequence rno-let-7i

AccessionMI0000835 (change log)
DescriptionRattus norvegicus let-7i stem-loop
Gene family MIPF0000002; let-7
Literature search

107 open access papers mention rno-let-7i
(575 sentences)

Stem-loop
        u                 u   --------  u     ugu 
5' cuggc gagguaguaguuugugc guu        gg cgggu   g
   ||||| ||||||||||||||||| |||        || |||||   a
3' gaucg uuccgucaucgaacgcg caa        uc gcccg   c
        -                 u   uagaggug  -     uua 
Get sequence
Deep sequencing
7610579 reads, 6.61e+03 reads per million, 512 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr7: 66802731-66802815 [+]
sense
ENSRNOT00000053765 ; Mirlet7i-201; exon 1
Database links

Mature sequence rno-let-7i-5p

Accession MIMAT0000779
Previous IDsrno-let-7i
Sequence

6 - 

ugagguaguaguuugugcuguu

 - 27

Get sequence
Deep sequencing7593666 reads, 512 experiments
Evidence experimental; cloned [1-5], SOLiD [6]
Predicted targets

Mature sequence rno-let-7i-3p

Accession MIMAT0004707
Previous IDsrno-let-7i*
Sequence

62 - 

cugcgcaagcuacugccuugcu

 - 83

Get sequence
Deep sequencing16863 reads, 479 experiments
Evidence experimental; cloned [4], SOLiD [6]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
6
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).