Stem-loop sequence rno-let-7f-2

AccessionMI0000834 (change log)
DescriptionRattus norvegicus let-7f-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

102 open access papers mention rno-let-7f-2
(504 sentences)

Stem-loop
   u      u   gu                uuagggucauac 
5'  guggga gag  aguagauuguauaguu            c
    |||||| |||  ||||||||||||||||             
3'  cacccu uuc  ucaucugacauaucaa            c
   g      -   ug                uagagguucuac 
Get sequence
Deep sequencing
21994357 reads, 2.02e+04 reads per million, 514 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 21583272-21583354 [+]
sense
ENSRNOT00000003882 ; Huwe1-201; intron 73
Clustered miRNAs
< 10kb from rno-let-7f-2
rno-let-7f-2chrX: 21583272-21583354 [+]
rno-mir-98chrX: 21583875-21583982 [+]
Database links

Mature sequence rno-let-7f-5p

Accession MIMAT0000778
Previous IDsrno-let-7f
Sequence

8 - 

ugagguaguagauuguauaguu

 - 29

Get sequence
Deep sequencing43436274 reads, 514 experiments
Evidence experimental; cloned [1-4], SOLiD [5]
Predicted targets

Mature sequence rno-let-7f-2-3p

Accession MIMAT0017090
Previous IDsrno-let-7f-2*
Sequence

58 - 

cuauacagucuacugucuuuc

 - 78

Get sequence
Deep sequencing83934 reads, 485 experiments
Evidence experimental; SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).