Stem-loop sequence rno-let-7f-1

AccessionMI0000833 (change log)
DescriptionRattus norvegicus let-7f-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

104 open access papers mention rno-let-7f-1
(506 sentences)

Stem-loop
   a    a ug                      ---------       u 
5'  ucag g  agguaguagauuguauaguugu         gggguag g
    |||| |  ||||||||||||||||||||||         ||||||| a
3'  aguc c  uccguuaucuaacauaucaaua         ucccauu u
   g    - cu                      gaggauuug       u 
Get sequence
Deep sequencing
21539041 reads, 1.98e+04 reads per million, 514 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr17: 16418221-16418309 [+]
antisense
ENSRNOT00000053661 ; Mir3596d-201; exon 1
Clustered miRNAs
< 10kb from rno-let-7f-1
rno-let-7a-1chr17: 16417853-16417946 [+]
rno-mir-3596dchr17: 16418217-16418313 [-]
rno-let-7f-1chr17: 16418221-16418309 [+]
rno-let-7dchr17: 16419980-16420077 [+]
rno-mir-3596bchr17: 16419981-16420075 [-]
Database links

Mature sequence rno-let-7f-5p

Accession MIMAT0000778
Previous IDsrno-let-7f
Sequence

8 - 

ugagguaguagauuguauaguu

 - 29

Get sequence
Deep sequencing43436274 reads, 514 experiments
Evidence experimental; cloned [1-4], SOLiD [5]
Predicted targets

Mature sequence rno-let-7f-1-3p

Accession MIMAT0017089
Previous IDsrno-let-7f-1*
Sequence

64 - 

cuauacaaucuauugccuucc

 - 84

Get sequence
Deep sequencing12312 reads, 471 experiments
Evidence experimental; SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).