Stem-loop sequence MI0000833

Accession MI0000833
ID rno-let-7f-1
Description Rattus norvegicus let-7f-1 stem-loop
Stem-loop 
a    a ug                      ---------       u 
 ucag g  agguaguagauuguauaguugu         gggguag g
 |||| |  ||||||||||||||||||||||         ||||||| a
 aguc c  uccguuaucuaacauaucaaua         ucccauu u
g    - cu                      gaggauuug       u
Get sequence
Genome context
Coordinates (RGSC3.4) Overlapping transcripts
17: 22120135-22120223 [+]
intergenic

View flanking features
Clustered miRNAs
< 10kb from rno-let-7f-1
rno-let-7a-1 17: 22119767-22119860 [+]
rno-let-7f-1 17: 22120135-22120223 [+]
rno-let-7d 17: 22121894-22121991 [+]
Database links
Gene family

MIPF0000002; let-7

Mature sequence MIMAT0000778

Accession MIMAT0000778
ID rno-let-7f
Sequence

8 -  

ugagguaguagauuguauaguu

 - 29

Get sequence
Evidence experimental; cloned [1-4]
Predicted targets

References

1
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
"Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
3
"A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
"Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).