Stem-loop sequence rno-let-7e

AccessionMI0000832 (change log)
DescriptionRattus norvegicus let-7e stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF0000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   c    cc  c   cu   g                u  ggaaga ac 
5'  gcgc  cc ggg  gag uaggagguuguauagu ga      c  c
    ||||  || |||  ||| |||||||||||||||| ||      |   
3'  cgcg  gg ccc  uuc auccuccggcauauca cu      g  c
   c    uc  a   cu   g                -  --agag ag 
Get sequence
Deep sequencing
706652 reads, 7.53e+03 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 59704381-59704473 [+]
antisense
ENSRNOT00000053576 ; Mir3596c-201; exon 1
Clustered miRNAs
< 10kb from rno-let-7e
rno-mir-99bchr1: 59704216-59704285 [+]
rno-mir-3596cchr1: 59704372-59704488 [-]
rno-let-7echr1: 59704381-59704473 [+]
rno-mir-125achr1: 59704827-59704911 [+]
Database links

Mature sequence rno-let-7e-5p

Accession MIMAT0000777
Previous IDsrno-let-7e
Sequence

15 - 

ugagguaggagguuguauaguu

 - 36

Get sequence
Deep sequencing705698 reads, 39 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

Mature sequence rno-let-7e-3p

Accession MIMAT0004706
Previous IDsrno-let-7e*
Sequence

60 - 

cuauacggccuccuagcuuucc

 - 81

Get sequence
Deep sequencing954 reads, 33 experiments
Evidence experimental; cloned [3], SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).