Stem-loop sequence rno-let-7e

AccessionMI0000832 (change log)
DescriptionRattus norvegicus let-7e stem-loop
Gene family MIPF0000002; let-7
Literature search

97 open access papers mention rno-let-7e
(562 sentences)

Stem-loop
   c    cc  c   cu   g                u  ggaaga ac 
5'  gcgc  cc ggg  gag uaggagguuguauagu ga      c  c
    ||||  || |||  ||| |||||||||||||||| ||      |   
3'  cgcg  gg ccc  uuc auccuccggcauauca cu      g  c
   c    uc  a   cu   g                -  --agag ag 
Get sequence
Deep sequencing
9073167 reads, 7.94e+03 reads per million, 514 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 59704381-59704473 [+]
antisense
ENSRNOT00000053576 ; Mir3596c-201; exon 1
Clustered miRNAs
< 10kb from rno-let-7e
rno-mir-99bchr1: 59704216-59704285 [+]
rno-mir-3596cchr1: 59704372-59704488 [-]
rno-let-7echr1: 59704381-59704473 [+]
rno-mir-125achr1: 59704827-59704911 [+]
Database links

Mature sequence rno-let-7e-5p

Accession MIMAT0000777
Previous IDsrno-let-7e
Sequence

15 - 

ugagguaggagguuguauaguu

 - 36

Get sequence
Deep sequencing9056431 reads, 514 experiments
Evidence experimental; cloned [1-3], SOLiD [4]
Predicted targets

Mature sequence rno-let-7e-3p

Accession MIMAT0004706
Previous IDsrno-let-7e*
Sequence

60 - 

cuauacggccuccuagcuuucc

 - 81

Get sequence
Deep sequencing16725 reads, 445 experiments
Evidence experimental; cloned [3], SOLiD [4]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).