Stem-loop sequence rno-let-7c-2

AccessionMI0000831 (change log)
DescriptionRattus norvegicus let-7c-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

100 open access papers mention rno-let-7c-2
(502 sentences)

Stem-loop
   a     -   g   u   gu                uugggcucugc 
5'  cggcc uuu ggg gag  aguagguuguaugguu           c
    ||||| ||| ||| |||  ||||||||||||||||            
3'  gccgg gaa ucc uuc  ucaucuaacauaucaa           c
   c     u   g   u   ug                uggcgucucgc 
Get sequence
Deep sequencing
20994631 reads, 1.92e+04 reads per million, 514 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr7: 126590212-126590306 [+]
intergenic
Clustered miRNAs
< 10kb from rno-let-7c-2
rno-let-7c-2chr7: 126590212-126590306 [+]
rno-let-7bchr7: 126590627-126590711 [+]
Database links

Mature sequence rno-let-7c-5p

Accession MIMAT0000776
Previous IDsrno-let-7c
Sequence

14 - 

ugagguaguagguuguaugguu

 - 35

Get sequence
Deep sequencing41806667 reads, 514 experiments
Evidence experimental; cloned [1-5], SOLiD [6]
Predicted targets

Mature sequence rno-let-7c-2-3p

Accession MIMAT0017088
Previous IDsrno-let-7c-2*
Sequence

62 - 

cuauacaaucuacugucuuucc

 - 83

Get sequence
Deep sequencing87357 reads, 485 experiments
Evidence experimental; SOLiD [6]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
6
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).