Stem-loop sequence rno-let-7c-1

AccessionMI0000830 (change log)
DescriptionRattus norvegicus let-7c-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

101 open access papers mention rno-let-7c-1
(508 sentences)

Stem-loop
   u      a      uu   g   u             ua  g ua a 
5'  gugugc uccggg  gag uag agguuguaugguu  ga u  c c
    |||||| ||||||  ||| ||| |||||||||||||  || |  | c
3'  cacacg agguuc  uuc auc uccaacaugucaa  uu a  g c
   u      -      cu   g   u             --  g gg u 
Get sequence
Deep sequencing
20902279 reads, 1.91e+04 reads per million, 514 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr11: 16052873-16052966 [+]
sense
ENSRNOT00000053623 ; Mirlet7c-1-201; exon 1
Clustered miRNAs
< 10kb from rno-let-7c-1
rno-mir-99achr11: 16052153-16052233 [+]
rno-let-7c-1chr11: 16052873-16052966 [+]
Database links

Mature sequence rno-let-7c-5p

Accession MIMAT0000776
Previous IDsrno-let-7c
Sequence

16 - 

ugagguaguagguuguaugguu

 - 37

Get sequence
Deep sequencing41806667 reads, 514 experiments
Evidence experimental; cloned [1-5], SOLiD [6]
Predicted targets

Mature sequence rno-let-7c-1-3p

Accession MIMAT0017087
Previous IDsrno-let-7c-1*
Sequence

61 - 

cuguacaaccuucuagcuuucc

 - 82

Get sequence
Deep sequencing2497 reads, 339 experiments
Evidence experimental; SOLiD [6]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
6
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).