Stem-loop sequence rno-let-7b

Accession MI0000829
Description Rattus norvegicus let-7b stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
g     u                     -  -----    ca   a 
 cgggg gagguaguagguugugugguu uc     aggg  gug u
 ||||| ||||||||||||||||||||| ||     ||||  |||  
 guccc uuccgucauccaacauaucaa ag     uccc  cgc g
a     -                     u  aagcc    --   u 
Get sequence
Genome context
Coordinates (RGSC3.4) Overlapping transcripts
7: 123701205-123701289 [+]
intergenic
Clustered miRNAs
< 10kb from rno-let-7b
rno-let-7c-2 7: 123700790-123700884 [+]
rno-let-7b 7: 123701205-123701289 [+]
Database links

Mature sequence rno-let-7b-5p

Accession MIMAT0000775
Previous IDs rno-let-7b
Sequence

7 - 

ugagguaguagguugugugguu

 - 28

Get sequence
Evidence experimental; cloned [1-4], SOLiD [5]
Validated targets
Predicted targets

Mature sequence rno-let-7b-3p

Accession MIMAT0004705
Previous IDs rno-let-7b*
Sequence

61 - 

cuauacaaccuacugccuuccc

 - 82

Get sequence
Evidence experimental; cloned [4], SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).