Stem-loop sequence rno-let-7a-2

AccessionMI0000828 (change log)
DescriptionRattus norvegicus let-7a-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

114 open access papers mention rno-let-7a-2
(829 sentences)

Stem-loop
   cg   u c       cu   g   u             uagaguuac 
5'   gca g ucccagg  gag uag agguuguauaguu         a
     ||| | |||||||  ||| ||| |||||||||||||         a
3'   cgu c aggguuc  uuc auc uccgacaugucaa         c
   ca   u -       cu   g   c             uagagggaa 
Get sequence
Deep sequencing
24506502 reads, 2.21e+04 reads per million, 514 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr8: 45753264-45753359 [+]
antisense
ENSRNOT00000053671 ; Mir3596a-201; exon 1
Clustered miRNAs
< 10kb from rno-let-7a-2
rno-mir-100chr8: 45746948-45747027 [+]
rno-mir-3596achr8: 45753254-45753367 [-]
rno-let-7a-2chr8: 45753264-45753359 [+]
Database links

Mature sequence rno-let-7a-5p

Accession MIMAT0000774
Previous IDsrno-let-7a
Sequence

17 - 

ugagguaguagguuguauaguu

 - 38

Get sequence
Deep sequencing49041012 reads, 514 experiments
Evidence experimental; cloned [1-4], SOLiD [5]
Predicted targets

Mature sequence rno-let-7a-2-3p

Accession MIMAT0017086
Previous IDsrno-let-7a-2*
Sequence

62 - 

cuguacagccuccuagcuuucc

 - 83

Get sequence
Deep sequencing1138 reads, 212 experiments
Evidence experimental; SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).