Stem-loop sequence rno-let-7a-1

AccessionMI0000827 (change log)
DescriptionRattus norvegicus let-7a-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

113 open access papers mention rno-let-7a-1
(829 sentences)

Stem-loop
   u     g     u   gu                uuagggucacac 
5'  ucacu uggga gag  aguagguuguauaguu            c
    ||||| ||||| |||  ||||||||||||||||            c
3'  agugg auccu uuc  ucaucuaacauaucaa            a
   u     a     -   ug                uagagggucacc 
Get sequence
Deep sequencing
24623325 reads, 2.21e+04 reads per million, 514 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr17: 16417853-16417946 [+]
sense
ENSRNOT00000053755 ; Mirlet7a-1-201; exon 1
Clustered miRNAs
< 10kb from rno-let-7a-1
rno-let-7a-1chr17: 16417853-16417946 [+]
rno-mir-3596dchr17: 16418217-16418313 [-]
rno-let-7f-1chr17: 16418221-16418309 [+]
rno-let-7dchr17: 16419980-16420077 [+]
rno-mir-3596bchr17: 16419981-16420075 [-]
Database links

Mature sequence rno-let-7a-5p

Accession MIMAT0000774
Previous IDsrno-let-7a
Sequence

13 - 

ugagguaguagguuguauaguu

 - 34

Get sequence
Deep sequencing49041012 reads, 514 experiments
Evidence experimental; cloned [1-4], SOLiD [5]
Predicted targets

Mature sequence rno-let-7a-1-3p

Accession MIMAT0017085
Previous IDsrno-let-7a-1*
Sequence

64 - 

cuauacaaucuacugucuuucc

 - 85

Get sequence
Deep sequencing87379 reads, 485 experiments
Evidence experimental; SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).