miRBase has moved to http://www.mirbase.org/ - please update your links.

Stem-loop sequence MI0000827

Accession MI0000827
ID rno-let-7a-1
Description Rattus norvegicus let-7a-1 stem-loop
Stem-loop 
u     g     u   gu                uuagggucacac 
 ucacu uggga gag  aguagguuguauaguu            c
 ||||| ||||| |||  ||||||||||||||||            c
 agugg auccu uuc  ucaucuaacauaucaa            a
u     a     -   ug                uagagggucacc
Get sequence
Genome context
Coordinates (RGSC3.4) Overlapping transcripts
17: 22119767-22119860 [+]
intergenic

View flanking features
Clustered miRNAs
< 10kb from rno-let-7a-1
rno-let-7a-1 17: 22119767-22119860 [+]
rno-let-7f-1 17: 22120135-22120223 [+]
rno-let-7d 17: 22121894-22121991 [+]
Gene family

MIPF0000002; let-7

Mature sequence MIMAT0000774

Accession MIMAT0000774
ID rno-let-7a
Sequence

13 -  

ugagguaguagguuguauaguu

 - 34

Get sequence
Evidence experimental; cloned [1-4]
Predicted targets

References

1
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
"Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
"Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4
"A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).