Stem-loop sequence hsa-mir-346

AccessionMI0000826
Symbol HGNC:MIR346
DescriptionHomo sapiens miR-346 stem-loop
Gene family MIPF0000188; mir-346
Stem-loop
   -g u      g ug    u    cu    -  aug        u  guug 
5'   g cucugu u  ggcg cugu  gccc gc   ccugccuc cu    c
     | |||||| |  |||| ||||  |||| ||   |||||||| ||     
3'   c gagacg g  ccgu gacg  cggg cg   ggacggag ga    u
   gg -      - gu    c    uc    u  --g        -  aguc 
Get sequence
Deep sequencing
151 reads, 102 reads per million, 29 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

This sequence is the predicted human homologue [2] of a sequence cloned from rat neuronal tissue [1]. The mature miRNA differs from the rat sequence at two positions, and its expression has not been verified in human.

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr10: 86264694-86264788 [-]
antisense
OTTHUMT00000049137 ; CCSER2-007; intron 4
OTTHUMT00000049138 ; CCSER2-008; intron 5
OTTHUMT00000049135 ; CCSER2-005; intron 5
OTTHUMT00000049133 ; CCSER2-003; intron 6
OTTHUMT00000049136 ; CCSER2-006; intron 6
OTTHUMT00000049132 ; CCSER2-002; intron 10
ENST00000480006 ; CCSER2-007; intron 4
ENST00000498300 ; CCSER2-008; intron 5
ENST00000466105 ; CCSER2-005; intron 5
ENST00000494144 ; CCSER2-003; intron 6
ENST00000493409 ; CCSER2-006; intron 6
ENST00000543283 ; CCSER2-202; intron 7
ENST00000372088 ; CCSER2-201; intron 9
ENST00000224756 ; CCSER2-002; intron 10
Database links

Mature sequence hsa-miR-346

Accession MIMAT0000773
Sequence

20 - 

ugucugcccgcaugccugccucu

 - 42

Get sequence
Deep sequencing29 reads, 15 experiments
Evidence by similarity; MI0000633
Validated targets
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2