Stem-loop sequence hsa-mir-345

Accession

MI0000825

Symbol

HGNC:MIR345

Description

Homo sapiens miR-345 stem-loop

Gene family

MIPF0000189; mir-345

Stem-loop

---------acc       u      g u       a  c         ug u 
            caaaccc aggucu c gacuccu gu cagggcucg  a g
            ||||||| |||||| | ||||||| || |||||||||  |  
            guuuggg uccgga g cugggga ca gucccgggu  u g
cgacagcuauaa       -      g u       g  a         gg c 

Deep sequencing

reads, experiments

Comments

This sequence is the predicted human homologue [2] of a sequence cloned from rat neuronal tissue [1], later validated in human [3,4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCh37.p5): chr14: 100774196-100774293 [+]
• Overlapping transcripts:

  intergenic

Database links

• ENTREZGENE: 442910;MIR345
• HGNC: 31779;MIR345

Mature sequence hsa-miR-345-5p

• Accession: MIMAT0000772
• Previous IDs: hsa-miR-345
• Sequence: 18 - gcugacuccuaguccagggcuc - 39
• Evidence: experimental; cloned [3-4], Northern [3]
• Validated targets:
  • TARBASE:hsa-miR-345-5p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-345-5p
  • MICRORNA.ORG:hsa-miR-345-5p
  • MIRDB:hsa-miR-345-5p
  • RNA22-HSA:hsa-miR-345-5p
  • TARGETMINER:hsa-miR-345-5p
  • TARGETSCAN-VERT:hsa-miR-345
  • PICTAR-VERT:hsa-miR-345

Mature sequence hsa-miR-345-3p

• Accession: MIMAT0022698
• Sequence: 54 - gcccugaacgaggggucuggag - 75
• Evidence: not experimental
• Predicted targets:
  • DIANA-MICROT:hsa-miR-345-3p
  • MIRDB:hsa-miR-345-3p
  • TARGETMINER:hsa-miR-345-3p
  • PICTAR-VERT:hsa-miR-345

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3. PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).