Stem-loop sequence hsa-mir-345

AccessionMI0000825 (change log)
Symbol HGNC:MIR345
DescriptionHomo sapiens miR-345 stem-loop
Gene family MIPF0000189; mir-345
Stem-loop
   ---------acc       u      g u       a  c         ug u 
5'             caaaccc aggucu c gacuccu gu cagggcucg  a g
               ||||||| |||||| | ||||||| || |||||||||  |  
3'             guuuggg uccgga g cugggga ca gucccgggu  u g
   cgacagcuauaa       -      g u       g  a         gg c 
Get sequence
Deep sequencing
31024 reads, 258 reads per million, 73 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is the predicted human homologue [2] of a sequence cloned from rat neuronal tissue [1], later validated in human [3,4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 100307859-100307956 [+]
sense
OTTHUMT00000413938 ; EML1-004; intron 1
OTTHUMT00000413939 ; EML1-006; intron 1
OTTHUMT00000413940 ; EML1-003; intron 1
OTTHUMT00000413941 ; EML1-007; intron 1
OTTHUMT00000413942 ; EML1-008; intron 1
OTTHUMT00000413943 ; EML1-001; intron 1
OTTHUMT00000413944 ; EML1-002; intron 1
OTTHUMT00000413945 ; EML1-009; intron 1
OTTHUMT00000413946 ; EML1-010; intron 1
OTTHUMT00000413947 ; EML1-011; intron 1
OTTHUMT00000413948 ; EML1-012; intron 1
ENST00000554479 ; EML1-004; intron 1
ENST00000555145 ; EML1-006; intron 1
ENST00000327921 ; EML1-003; intron 1
ENST00000556199 ; EML1-007; intron 1
ENST00000556835 ; EML1-008; intron 1
ENST00000262233 ; EML1-001; intron 1
ENST00000334192 ; EML1-002; intron 1
ENST00000555096 ; EML1-009; intron 1
ENST00000556714 ; EML1-010; intron 1
ENST00000553720 ; EML1-011; intron 1
ENST00000556947 ; EML1-012; intron 1
Database links

Mature sequence hsa-miR-345-5p

Accession MIMAT0000772
Previous IDshsa-miR-345
Sequence

18 - 

gcugacuccuaguccagggcuc

 - 39

Get sequence
Deep sequencing30611 reads, 72 experiments
Evidence experimental; cloned [3-4], Northern [3]
Database links
Predicted targets

Mature sequence hsa-miR-345-3p

Accession MIMAT0022698
Sequence

54 - 

gcccugaacgaggggucuggag

 - 75

Get sequence
Deep sequencing263 reads, 31 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).