Stem-loop sequence hsa-mir-325

Accession MI0000824
Symbol HGNC:MIR325
Description Homo sapiens miR-325 stem-loop
Gene family MIPF0000147; mir-325
Stem-loop 
----------a              cc   u    g c      gu uu gug 
           uacagugcuugguu  uag aggu u caguaa  g  u   a
           ||||||||||||||  ||| |||| | ||||||  |  |    
           gugucacgaacuaa  auc ucca g guuauu  u  a   c
ggucucggauc              cu   c    g a      ug uu aua
Get sequence
Deep sequencing
2 reads, 2 experiments
Comments

This sequence is the predicted human homologue [2] of a sequence cloned from rat neuronal tissue [1]. The mature miRNA differs from the rat sequence at two positions, and its expression has not been verified in human.

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chrX: 76225829-76225926 [-]
intergenic
Database links

Mature sequence hsa-miR-325

Accession MIMAT0000771
Sequence

16 -  

ccuaguagguguccaguaagugu

 - 38

Get sequence
Evidence by similarity; MI0000596
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).