Stem-loop sequence mmu-mir-181b-2

AccessionMI0000823 (change log)
Symbol MGI:Mir181b-2
DescriptionMus musculus miR-181b-2 stem-loop
Gene family MIPF0000007; mir-181
Literature search

163 open access papers mention mmu-mir-181b-2
(1244 sentences)

Stem-loop
   uuga     -   cucaa         cu           ---  a 
5'     uggcu gca     cauucauug  gucgguggguu   ug a
       ||||| |||     |||||||||  |||||||||||   || u
3'     accgg cgu     guaaguaac  uagucacucaa   ac g
   aaaa     g   caaac         --           cca  u 
Get sequence
Deep sequencing
1527438 reads, 2.47e+03 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 38853830-38853918 [+]
antisense
OTTMUST00000030867 ; Nr6a1-002; intron 2
OTTMUST00000029378 ; Nr6a1-001; intron 4
ENSMUST00000142130 ; Nr6a1-002; intron 2
ENSMUST00000076275 ; Nr6a1-201; intron 3
ENSMUST00000112877 ; Nr6a1-001; intron 4
Clustered miRNAs
< 10kb from mmu-mir-181b-2
mmu-mir-181a-2chr2: 38852735-38852810 [+]
mmu-mir-181b-2chr2: 38853830-38853918 [+]
Database links

Mature sequence mmu-miR-181b-5p

Accession MIMAT0000673
Previous IDsmmu-miR-181b
Sequence

16 - 

aacauucauugcugucgguggguu

 - 39

Get sequence
Deep sequencing3015553 reads, 107 experiments
Evidence experimental; cloned [2-4], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-miR-181b-2-3p

Accession MIMAT0017084
Previous IDsmmu-miR-181b-2*
Sequence

54 - 

cucacugaucaaugaaugcaaa

 - 75

Get sequence
Deep sequencing6652 reads, 91 experiments
Evidence experimental; Illumina [6]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).