Stem-loop sequence hsa-mir-133b

AccessionMI0000822 (change log)
Symbol HGNC:MIR133B
DescriptionHomo sapiens miR-133b stem-loop
Gene family MIPF0000029; mir-133
Literature search

328 open access papers mention hsa-mir-133b
(1837 sentences)

Stem-loop
   c   a  a  --aa --a    --       c        ca  c  a      u  g      
5'  cuc ga ga    g   ugcc  cccugcu uggcuggu  aa gg accaag cc ucuuc 
    ||| || ||    |   ||||  ||||||| ||||||||  || || |||||| || |||| c
3'  gag uu cu    c   acgg  gggacga aucgacca  uu cc ugguuu gg agagu 
   a   g  c  gacc gua    uc       c        ac  c  c      -  -      
Get sequence
Deep sequencing
48341 reads, 225 reads per million, 145 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

miR-133b was predicted based on comparative analysis of human, mouse and Fugu [1], and later verified in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 52148923-52149041 [+]
antisense
OTTHUMT00000470784 ; MCM3-006; intron 1
OTTHUMT00000040897 ; MCM3-001; intron 1
OTTHUMT00000464551 ; MCM3-005; intron 1
ENST00000229854 ; MCM3-006; intron 1
ENST00000596288 ; MCM3-001; intron 1
ENST00000596983 ; MCM3-005; intron 1
ENST00000419835 ; MCM3-201; intron 1
Clustered miRNAs
< 10kb from hsa-mir-133b
hsa-mir-206chr6: 52144349-52144434 [+]
hsa-mir-133bchr6: 52148923-52149041 [+]
Database links

Mature sequence hsa-miR-133b

Accession MIMAT0000770
Sequence

66 - 

uuugguccccuucaaccagcua

 - 87

Get sequence
Deep sequencing48330 reads, 143 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).