Stem-loop sequence hsa-mir-133b

Accession MI0000822
Symbol HGNC:MIR133B
Description Homo sapiens miR-133b stem-loop
Gene family MIPF0000029; mir-133
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-133_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-133 is a type of non-coding RNA called a microRNA that was first experimentally characterised in mice. Homologues have since been discovered in several other species including invertebrates such as the fruitfly Drosophila melanogaster. Each species often encodes multiple microRNAs with identical or similar mature sequence. For example, in the human genome there are three known miR-133 genes: miR-133a-1, miR-133a-2 and miR-133b found on chromosomes 18, 20 and 6 respectively. The mature sequence is excised from the 3' arm of the hairpin. miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c   a  a  --aa --a    --       c        ca  c  a      u  g      
 cuc ga ga    g   ugcc  cccugcu uggcuggu  aa gg accaag cc ucuuc 
 ||| || ||    |   ||||  ||||||| ||||||||  || || |||||| || |||| c
 gag uu cu    c   acgg  gggacga aucgacca  uu cc ugguuu gg agagu 
a   g  c  gacc gua    uc       c        ac  c  c      -  -      
Get sequence
Deep sequencing
133 reads, 11 experiments
Comments

miR-133b was predicted based on comparative analysis of human, mouse and Fugu [1], and later verified in human [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr6: 52013721-52013839 [+]
antisense
OTTHUMT00000040895 ; RP11-771D21.2-001; intron 2
OTTHUMT00000040895 ; RP11-771D21.2-001; intron 2
OTTHUMT00000040895 ; RP11-771D21.2-001; intron 2
ENST00000418518 ; RP11-771D21.2-001; intron 2
ENST00000418518 ; RP11-771D21.2-001; intron 2
ENST00000418518 ; RP11-771D21.2-001; intron 2
Clustered miRNAs
< 10kb from hsa-mir-133b
hsa-mir-206 chr6: 52009147-52009232 [+]
hsa-mir-133b chr6: 52013721-52013839 [+]
Database links

Mature sequence hsa-miR-133b

Accession MIMAT0000770
Sequence

66 - 

uuugguccccuucaaccagcua

 - 87

Get sequence
Deep sequencing 132 reads, 10 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).