Stem-loop sequence mmu-mir-133a-2

AccessionMI0000820 (change log)
Symbol MGI:Mir133a-2
DescriptionMus musculus miR-133a-2 stem-loop
Gene family MIPF0000029; mir-133
Literature search

236 open access papers mention mmu-mir-133a-2
(1677 sentences)

Stem-loop
   a aa  ----ca     uuu    a       aa  u  a        -ag u 
5'  g  gc      aaugc   gcug agcuggu  aa gg accaaauc   c g
    |  ||      |||||   |||| |||||||  || || ||||||||   | u
3'  c  cg      uuacg   cgau ucgacca  uu cc ugguuuag   g u
   a gc  cacuag     cgu    g       ac  c  c        gua g 
Get sequence
Deep sequencing
188971 reads, 1.71e+03 reads per million, 79 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This mature miRNA sequence was named miR-133 in reference [1], and renamed miR-133a on subsequent identification of a homologue differing at the terminal 3' position (MI0000821). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 180398379-180398482 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-133a-2
mmu-mir-1a-1chr2: 180389048-180389124 [+]
mmu-mir-133a-2chr2: 180398379-180398482 [+]
Database links

Mature sequence mmu-miR-133a-5p

Accession MIMAT0003473
Previous IDsmmu-miR-133a*
Sequence

23 - 

gcugguaaaauggaaccaaau

 - 43

Get sequence
Deep sequencing19809 reads, 47 experiments
Evidence experimental; MPSS [2], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-133a-3p

Accession MIMAT0000145
Previous IDsmmu-miR-133a
Sequence

59 - 

uuugguccccuucaaccagcug

 - 80

Get sequence
Deep sequencing357949 reads, 76 experiments
Evidence experimental; cloned [1,3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).