Stem-loop sequence mmu-mir-133a-2

Accession MI0000820
Symbol MGI:Mir133a-2
Description Mus musculus miR-133a-2 stem-loop
Gene family MIPF0000029; mir-133
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-133_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-133 is a type of non-coding RNA called a microRNA that was first experimentally characterised in mice. Homologues have since been discovered in several other species including invertebrates such as the fruitfly Drosophila melanogaster. Each species often encodes multiple microRNAs with identical or similar mature sequence. For example, in the human genome there are three known miR-133 genes: miR-133a-1, miR-133a-2 and miR-133b found on chromosomes 18, 20 and 6 respectively. The mature sequence is excised from the 3' arm of the hairpin. miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
a aa  ----ca     uuu    a       aa  u  a        -ag u 
 g  gc      aaugc   gcug agcuggu  aa gg accaaauc   c g
 |  ||      |||||   |||| |||||||  || || ||||||||   | u
 c  cg      uuacg   cgau ucgacca  uu cc ugguuuag   g u
a gc  cacuag     cgu    g       ac  c  c        gua g 
Get sequence
Deep sequencing
389299 reads, 74 experiments
Comments

This mature miRNA sequence was named miR-133 in reference [1], and renamed miR-133a on subsequent identification of a homologue differing at the terminal 3' position (MI0000821 ). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr2: 180398379-180398482 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-133a-2
mmu-mir-1a-1 chr2: 180389048-180389124 [+]
mmu-mir-133a-2 chr2: 180398379-180398482 [+]
Database links

Mature sequence mmu-miR-133a-5p

Accession MIMAT0003473
Previous IDs mmu-miR-133a*
Sequence

23 - 

gcugguaaaauggaaccaaau

 - 43

Get sequence
Deep sequencing 12319 reads, 38 experiments
Evidence experimental; MPSS [2], Solexa [4-5]
Validated targets
Predicted targets

Mature sequence mmu-miR-133a-3p

Accession MIMAT0000145
Previous IDs mmu-miR-133a
Sequence

59 - 

uuugguccccuucaaccagcug

 - 80

Get sequence
Deep sequencing 357842 reads, 60 experiments
Evidence experimental; cloned [1,3], Solexa [4-5]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).