Stem-loop sequence cbr-lsy-6

AccessionMI0000818 (change log)
DescriptionCaenorhabditis briggsae lsy-6 stem-loop
Gene family MIPF0000265; lsy-6
Stem-loop
   -    a         ca   u       a    aaag 
5'  ccac gaaugcguc  gua caaaauc cauc    a
    |||| |||||||||  ||| ||||||| ||||    g
3'  ggug cuuacgcag  uau guuuuag gugg    a
   c    c         ag   -       -    caua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrV: 10397386-10397459 [-]
intergenic
Database links

Mature sequence cbr-lsy-6

Accession MIMAT0000767
Sequence

50 - 

uuuuguaugagacgcauuccg

 - 70

Get sequence
Evidence by similarity; MI0000801

References

1
2