Stem-loop sequence mmu-mir-335

AccessionMI0000817 (change log)
Symbol MGI:Mir335
DescriptionMus musculus miR-335 stem-loop
Gene family MIPF0000196; mir-335
Stem-loop
   --------ucuuu    c        a         c        uuu    u 
5'              uggg ggggguca gagcaauaa gaaaaaug   guuu u
                |||| |||||||| ||||||||| ||||||||   |||| c
3'              acuc cccccagu cucguuauu cuuuuugc   caaa g
   accgauauugggu    u        c         a        ---    u 
Get sequence
Deep sequencing
192526 reads, 2.31e+03 reads per million, 59 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 30741299-30741396 [+]
sense
OTTMUST00000034125 ; Mest-009; intron 1
OTTMUST00000034123 ; Mest-006; intron 2
OTTMUST00000034121 ; Mest-004; intron 2
OTTMUST00000034118 ; Mest-002; intron 2
OTTMUST00000034117 ; Mest-001; intron 2
OTTMUST00000034119 ; Mest-003; intron 3
OTTMUST00000034122 ; Mest-005; intron 3
ENSMUST00000137521 ; Mest-009; intron 1
ENSMUST00000115127 ; Mest-006; intron 2
ENSMUST00000147400 ; Mest-004; intron 2
ENSMUST00000157040 ; Mest-002; intron 2
ENSMUST00000128398 ; Mest-001; intron 2
ENSMUST00000163949 ; Mest-201; intron 2
ENSMUST00000151777 ; Mest-003; intron 3
ENSMUST00000124665 ; Mest-005; intron 3
Database links

Mature sequence mmu-miR-335-5p

Accession MIMAT0000766
Previous IDsmmu-miR-335
Sequence

16 - 

ucaagagcaauaacgaaaaaugu

 - 38

Get sequence
Deep sequencing178046 reads, 59 experiments
Evidence experimental; cloned [3], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-miR-335-3p

Accession MIMAT0004704
Sequence

56 - 

uuuuucauuauugcuccugacc

 - 77

Get sequence
Deep sequencing14478 reads, 44 experiments
Evidence experimental; cloned [3], Illumina [5-6]
Database links
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).